ID: 1082105984

View in Genome Browser
Species Human (GRCh38)
Location 11:48222440-48222462
Sequence TGCTGCTGACCCTGATTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082105984_1082105988 7 Left 1082105984 11:48222440-48222462 CCTCTTAATCAGGGTCAGCAGCA No data
Right 1082105988 11:48222470-48222492 CCTCGTCCCTGGCACAGTGAAGG No data
1082105984_1082105985 -4 Left 1082105984 11:48222440-48222462 CCTCTTAATCAGGGTCAGCAGCA No data
Right 1082105985 11:48222459-48222481 AGCAAGACTGCCCTCGTCCCTGG No data
1082105984_1082105992 28 Left 1082105984 11:48222440-48222462 CCTCTTAATCAGGGTCAGCAGCA No data
Right 1082105992 11:48222491-48222513 GGCTCTGTGGCTTTAATTTCAGG No data
1082105984_1082105991 15 Left 1082105984 11:48222440-48222462 CCTCTTAATCAGGGTCAGCAGCA No data
Right 1082105991 11:48222478-48222500 CTGGCACAGTGAAGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082105984 Original CRISPR TGCTGCTGACCCTGATTAAG AGG (reversed) Intergenic
No off target data available for this crispr