ID: 1082106561

View in Genome Browser
Species Human (GRCh38)
Location 11:48227825-48227847
Sequence GCTGCCTGTCTGTCACCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082106558_1082106561 24 Left 1082106558 11:48227778-48227800 CCAATATATGGCCAACTGCAAAC No data
Right 1082106561 11:48227825-48227847 GCTGCCTGTCTGTCACCTTCTGG No data
1082106559_1082106561 13 Left 1082106559 11:48227789-48227811 CCAACTGCAAACTTTATTACTAC No data
Right 1082106561 11:48227825-48227847 GCTGCCTGTCTGTCACCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082106561 Original CRISPR GCTGCCTGTCTGTCACCTTC TGG Intergenic
No off target data available for this crispr