ID: 1082108488

View in Genome Browser
Species Human (GRCh38)
Location 11:48245654-48245676
Sequence AATCAGCAGACCAATGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082108488_1082108497 17 Left 1082108488 11:48245654-48245676 CCTTCCTCATTGGTCTGCTGATT 0: 1
1: 0
2: 1
3: 23
4: 197
Right 1082108497 11:48245694-48245716 CCTGTCTGTGATCAGTTTTGGGG 0: 1
1: 0
2: 0
3: 16
4: 215
1082108488_1082108495 16 Left 1082108488 11:48245654-48245676 CCTTCCTCATTGGTCTGCTGATT 0: 1
1: 0
2: 1
3: 23
4: 197
Right 1082108495 11:48245693-48245715 CCCTGTCTGTGATCAGTTTTGGG 0: 1
1: 0
2: 1
3: 13
4: 175
1082108488_1082108493 15 Left 1082108488 11:48245654-48245676 CCTTCCTCATTGGTCTGCTGATT 0: 1
1: 0
2: 1
3: 23
4: 197
Right 1082108493 11:48245692-48245714 ACCCTGTCTGTGATCAGTTTTGG 0: 1
1: 0
2: 0
3: 11
4: 153
1082108488_1082108491 -9 Left 1082108488 11:48245654-48245676 CCTTCCTCATTGGTCTGCTGATT 0: 1
1: 0
2: 1
3: 23
4: 197
Right 1082108491 11:48245668-48245690 CTGCTGATTGTTGCCAATGGAGG 0: 1
1: 0
2: 0
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082108488 Original CRISPR AATCAGCAGACCAATGAGGA AGG (reversed) Exonic
900517172 1:3088001-3088023 AAACAGCAGTGAAATGAGGAGGG - Intronic
900789549 1:4670697-4670719 AAACTGGAGACCAATGAGGCTGG - Intronic
906259389 1:44375224-44375246 ACCCAGCAGACCAATGAGGCTGG + Intergenic
907563063 1:55409017-55409039 AATATGCAAACCAATGAGCATGG + Intergenic
908862521 1:68505783-68505805 AATCAGCAGTTCAAAGAAGAGGG - Intergenic
909764830 1:79342441-79342463 AATCTCCAGACTAATTAGGATGG + Intergenic
910842817 1:91577204-91577226 AACCAGCAGACAACTGAAGAAGG - Intergenic
911670988 1:100607405-100607427 AGTCAGGAGAAAAATGAGGAGGG - Intergenic
914215078 1:145618743-145618765 AATCAGCAGAACAATGTGAAGGG - Intronic
914467025 1:147939140-147939162 AATCAGCAGAACAATGTGAAGGG - Intronic
916975783 1:170075893-170075915 AATAGGAAGTCCAATGAGGAAGG - Intronic
917492147 1:175506765-175506787 AATCATCACAACAATGAGGCAGG + Intronic
918415592 1:184303618-184303640 AATAAGCACACCAAAGAGAATGG + Intergenic
918517140 1:185375731-185375753 AAGCAGGAGACCAATGTGGCAGG - Intergenic
921919126 1:220646400-220646422 AATCAGAGGACCAAAGAAGATGG + Intronic
922113091 1:222581811-222581833 AACAAGGAGACCAGTGAGGATGG + Intronic
922747853 1:228056235-228056257 GATCATCAGACCTCTGAGGAAGG + Intronic
923106053 1:230854791-230854813 CAGCAGGAGACCTATGAGGAGGG - Intronic
923168730 1:231393226-231393248 AATCAGCAGACCCATAGGTAAGG + Intronic
1063881462 10:10536901-10536923 AAGAAGCAGACCTCTGAGGAGGG + Intergenic
1065644369 10:27819119-27819141 AATCATCAGACAAAATAGGAAGG - Intronic
1069226057 10:65945762-65945784 AATCTTCAAACCAATGAAGAAGG - Intronic
1070112747 10:73500566-73500588 AATCAGTATACCTATGGGGAGGG - Intronic
1070299288 10:75191265-75191287 ATACAGGAGACCAATGAGAAGGG - Intergenic
1070410803 10:76138153-76138175 AATTTACAGACCAATTAGGATGG + Intronic
1070457858 10:76634615-76634637 TCTCAGCACAGCAATGAGGATGG - Intergenic
1070853512 10:79586305-79586327 AATAGGCAGACCTCTGAGGAAGG + Intergenic
1071242443 10:83722788-83722810 AATGAGCAGAGCAATGGGCATGG - Intergenic
1071929004 10:90444532-90444554 TATCAGCAGACCATTCATGAAGG - Intergenic
1072697728 10:97616401-97616423 AGTCAGCAGGCCTTTGAGGAGGG + Exonic
1072817991 10:98528467-98528489 AAGCAGGAGAGCAAAGAGGATGG + Intronic
1073775542 10:106781681-106781703 CATCTGCTGACCAATGAGGGTGG + Intronic
1074274476 10:111988317-111988339 CATCAGCAGCCCAATGAGCAAGG - Intergenic
1075301534 10:121328932-121328954 AATGGGCACACCAATGAGGTGGG + Intergenic
1076328382 10:129645923-129645945 AACCAGCAGACCACTGCAGAAGG + Intronic
1076542743 10:131224342-131224364 AGGCAGCAGACCCAGGAGGATGG - Intronic
1076986844 11:243548-243570 AATAAGAAGACCACTGTGGAAGG - Intronic
1079617628 11:22514507-22514529 AGTCAGCACTCCAAAGAGGATGG + Intergenic
1080128362 11:28764687-28764709 AATGAGCATACCAATGTGGTTGG + Intergenic
1080151765 11:29059440-29059462 AATCAACAGTCCAGTGGGGAAGG + Intergenic
1082108488 11:48245654-48245676 AATCAGCAGACCAATGAGGAAGG - Exonic
1082110063 11:48264429-48264451 GATCAGCAGGCTAATGAAGAAGG - Exonic
1082211674 11:49510677-49510699 AATAAGAAGTCCAAAGAGGAGGG + Intergenic
1083547086 11:63556871-63556893 AAGCAGCAGACAGATGAGGCAGG - Intronic
1085131011 11:74038600-74038622 TATCAGCAGAAGTATGAGGAAGG - Intronic
1088040368 11:105374464-105374486 AATCAACAGAAAAATGAGGAAGG + Intergenic
1088889525 11:114033540-114033562 ACTCAGCAGACCAGTGAGGAAGG + Intergenic
1090311978 11:125749064-125749086 AAGCAGCAGAGGAAAGAGGAAGG - Exonic
1091309049 11:134560032-134560054 TATCAACAGCCCTATGAGGAAGG - Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1095532069 12:43200249-43200271 ACTCAGCAACCCTATGAGGAAGG - Intergenic
1095815413 12:46416799-46416821 AATAAGAAGATGAATGAGGAAGG - Intergenic
1095843293 12:46718244-46718266 AATCTATAGACTAATGAGGAAGG - Intergenic
1098798626 12:74924284-74924306 AATCTTCTGACAAATGAGGATGG + Intergenic
1099446692 12:82761368-82761390 AAACTGCAGAGCAATGAGGGTGG + Intronic
1100490993 12:95077708-95077730 TAACAGCAGGGCAATGAGGATGG + Exonic
1100662421 12:96714601-96714623 AATCAAAAGGCCAAGGAGGATGG + Intronic
1104088798 12:125497156-125497178 CAACAGCAGGGCAATGAGGAAGG - Intronic
1105814894 13:24026284-24026306 AATCAGCAGAAAACAGAGGAGGG - Intronic
1107266436 13:38561409-38561431 GACAACCAGACCAATGAGGAGGG - Intergenic
1107665565 13:42686384-42686406 AATGTGCAGACCAAAGAGGTTGG - Intergenic
1111215551 13:85135642-85135664 ACTCAGCAACTCAATGAGGAAGG + Intergenic
1111405112 13:87793554-87793576 AACCAGCAGAACAGTGATGATGG - Intergenic
1112907500 13:104442970-104442992 TACAAGGAGACCAATGAGGAAGG + Intergenic
1112973690 13:105291216-105291238 CATCGGCACACCAATGAGAAAGG + Intergenic
1114901254 14:27062028-27062050 AAGCTGCAGACCAAAGAGGCAGG - Intergenic
1117036075 14:51731132-51731154 AACCAACAGTCCAATGATGACGG - Intergenic
1117205933 14:53443638-53443660 AATCACCAGGCCATTGAAGATGG + Intergenic
1117344779 14:54821367-54821389 AATCTGCAGATAAATGAGTAAGG - Intergenic
1119730644 14:76948813-76948835 AGTAAGGAGACCAATAAGGAAGG - Intergenic
1119776406 14:77251825-77251847 AATCACCATGGCAATGAGGAGGG - Exonic
1120673375 14:87389937-87389959 AATACGCAGAGCAAAGAGGAAGG + Intergenic
1125752858 15:42041914-42041936 AGTCAGCAGACAAATGATGGGGG + Intronic
1126216780 15:46164432-46164454 AATAAGCAGACCATGGAGAACGG - Intergenic
1126301137 15:47197377-47197399 AATCAGAAGAACAATTAGGATGG + Intronic
1126422963 15:48494689-48494711 AATCAGCAAAACCATGAGCAAGG + Intronic
1126567121 15:50112423-50112445 AAAAAGCAGGCCAAGGAGGAAGG + Intronic
1128667662 15:69550375-69550397 AATCAGCAACCCAAAGAGGTGGG - Intergenic
1128712026 15:69879117-69879139 AACCAGCAAACCATTGCGGATGG - Intergenic
1129241539 15:74255192-74255214 GATGAGGAGATCAATGAGGAAGG - Intronic
1129453854 15:75665749-75665771 AACCAGCCGACCAATGAGTCTGG - Intergenic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1130865409 15:87929472-87929494 AATCAGGAGATCAAGGAGAAAGG + Intronic
1135941673 16:26827414-26827436 AATCTGCAGACCTGTGAGCACGG - Intergenic
1138486294 16:57346435-57346457 AATAAGAAGACCTAGGAGGAGGG + Intergenic
1138594432 16:58022287-58022309 AGTCAGCAGATCAATGCGGTGGG - Intergenic
1139277056 16:65737686-65737708 AATCAGCAGTTTAATGAGAATGG - Intergenic
1139512410 16:67435093-67435115 ACTCAGGAGACCGAGGAGGAAGG + Intronic
1143106354 17:4532390-4532412 TCTCAGCAGCCCAATTAGGAAGG + Intronic
1144434378 17:15226770-15226792 ACTCAGCAGACTAGTGATGAAGG - Intergenic
1145114978 17:20200766-20200788 CATCATCAGACCAATGATGATGG - Intronic
1146605976 17:34257968-34257990 AATCTTCAGTCCAATGAGGAGGG + Intergenic
1150021930 17:61625518-61625540 AATCTGCAGGTCAATGAGGAAGG - Intergenic
1150478229 17:65489874-65489896 AATCATCAGGCTAATGAGGCTGG + Intergenic
1150686998 17:67328934-67328956 AATCACCAGACCAATAACTAGGG - Intergenic
1151515629 17:74593305-74593327 AATCAGCAGACACTTGAGGAAGG - Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152577672 17:81149922-81149944 GAGCAGCTGACCCATGAGGAGGG + Intronic
1152988427 18:340454-340476 AATAAGCAGTTCAAAGAGGATGG + Intronic
1157111393 18:44823820-44823842 ACTAAGCAGAACAATGAGGGTGG - Intronic
1157430414 18:47619906-47619928 ATTCAGCAGGGGAATGAGGATGG + Intergenic
1160074083 18:75655406-75655428 AATCAGTGGAATAATGAGGAAGG + Intergenic
1162212400 19:9102809-9102831 AATCAGCAGGCCACAGAGGCGGG + Exonic
1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG + Exonic
1164172203 19:22735080-22735102 ATTCAGCACACCAAGGAGGCTGG - Intergenic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
1168103254 19:54152349-54152371 AAGCAGCGGGCCAAAGAGGAGGG + Intronic
926574504 2:14565172-14565194 CAACAGCAGAGCAATGAGGAAGG + Intergenic
928681964 2:33711846-33711868 AATCAACAGATCAAGGATGAGGG - Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
930748055 2:54904805-54904827 AATCAGGAGAACGATGATGAAGG + Intronic
931167963 2:59770291-59770313 GATCACCAGAGCAAGGAGGAGGG - Intergenic
932613653 2:73218360-73218382 ATTCAGCTGACCAAGGAAGAAGG + Intronic
933155003 2:78963604-78963626 AATCCGCAGCCCTGTGAGGATGG + Intergenic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
935434677 2:103016830-103016852 ACTCATCAGACCAATCAGGATGG + Intergenic
935803437 2:106723186-106723208 AATCAGCAAACAGACGAGGAAGG + Intergenic
940661098 2:156546283-156546305 AATAAGCAGATCAATTAGGTGGG + Intronic
945816503 2:214611181-214611203 AGTCAGCATAACTATGAGGATGG - Intergenic
946064262 2:216973268-216973290 AATGAGCATATCAATGAGGAAGG + Intergenic
946512632 2:220375826-220375848 AATCAGCATATAAATGACGACGG - Intergenic
948028838 2:234800138-234800160 TAACAGCAGAGCAAGGAGGATGG + Intergenic
948133724 2:235620430-235620452 GATCAGCAGAGCCATGAGCAAGG - Intronic
1169698146 20:8415182-8415204 AATCAACAGATCAATCAGCAGGG - Intronic
1170646836 20:18204024-18204046 AATCAGCTGATTAATGAGAAAGG + Intergenic
1170850919 20:20003789-20003811 TAACAGCTGCCCAATGAGGACGG - Intergenic
1170991038 20:21302199-21302221 AGTCATCAGACCACAGAGGAGGG + Intergenic
1171061533 20:21968060-21968082 ATTTGGCAGATCAATGAGGAAGG + Intergenic
1173011682 20:39189051-39189073 AATCAGCAGAAGAATAAGGGAGG + Intergenic
1173397001 20:42689237-42689259 AACCAGCAGACCAGTGACAATGG + Intronic
1174721461 20:52817356-52817378 AGTAAACAGACCAATTAGGAAGG + Intergenic
1178016417 21:28351453-28351475 AAACACCAGCCCAGTGAGGAGGG + Intergenic
1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG + Intronic
1180886064 22:19244761-19244783 ACTCAGCAGCCCCATGAGGTGGG - Intronic
1181976199 22:26732065-26732087 AAGCAGCAGAGCAAGGAGGAGGG - Intergenic
949305769 3:2638978-2639000 AAAAGGCAGACCAATGAGGAGGG - Intronic
949779215 3:7666999-7667021 TCTCAGCAGACCTATGAGGTTGG + Intronic
950716816 3:14853563-14853585 AATCTCCACACCAGTGAGGATGG + Intronic
955444008 3:58988488-58988510 AATCAGCAGAGCATTGAGATGGG + Intronic
959132504 3:102374587-102374609 AATCAGAACAGCAAGGAGGATGG - Intronic
959598989 3:108157915-108157937 AATCAGAAAACCAAAGAGCAAGG - Intergenic
960196574 3:114775937-114775959 AATCTGCAGACCATTGATCATGG + Intronic
960605059 3:119496736-119496758 AATAAGCAGACTACAGAGGAGGG + Intergenic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
966448389 3:180029870-180029892 GATCAGCAGATCACTGAGGATGG + Intronic
967710050 3:192696410-192696432 AATCAGCAAACAGATGAGGGAGG + Intronic
971311788 4:25531422-25531444 AATCAGCTGCCCCATGAAGATGG + Intergenic
973089976 4:46124129-46124151 AATCAGTAGCCCAAGGAGGCGGG + Intergenic
973580460 4:52339404-52339426 ACTCAGCAAAGCTATGAGGATGG + Intergenic
973710705 4:53627689-53627711 AGTCAGCACACCTCTGAGGATGG + Intronic
975948848 4:79743381-79743403 AATTACCAGGTCAATGAGGATGG - Intergenic
979123029 4:116926833-116926855 AATGAGCAGAGGAATGTGGATGG + Intergenic
980480371 4:133379801-133379823 GACCAGCAGACCAGTGAGGGCGG + Intergenic
982691926 4:158558216-158558238 AATGAGGACACCAATGAGGAAGG - Intronic
983019812 4:162661615-162661637 AAACAGCAGAACAAAGATGAGGG + Intergenic
983706499 4:170666641-170666663 AATCTGCAGACTACTGAAGAGGG + Intergenic
985404920 4:189628523-189628545 TATCATCAGACAAAGGAGGAAGG + Intergenic
987043487 5:14085138-14085160 CATCAGGGGACCCATGAGGAAGG - Intergenic
989774731 5:45190812-45190834 AATCATCATAACAATGACGAAGG - Intergenic
990549502 5:56860023-56860045 GATCTGCAGACCCCTGAGGATGG + Intronic
994785208 5:104151009-104151031 AATCACTAGACCTATGAGTATGG - Intergenic
997812391 5:136984461-136984483 CTTCAGCAAACCAATGAGAATGG + Intronic
999148511 5:149411451-149411473 ACTCAGTAGACCAATGAGACAGG - Intergenic
1000503053 5:162076744-162076766 AATCTGGAGAGTAATGAGGAAGG + Intronic
1000731360 5:164838011-164838033 AACCAGCAGAAAAATGAGGAAGG - Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003270912 6:4607113-4607135 AGACAGCAGAGCAATGAGGATGG - Intergenic
1004735181 6:18398688-18398710 CATCAGCAGAAGAATGAGGCTGG - Intronic
1005112453 6:22297922-22297944 AATCAGGAGTCATATGAGGAAGG + Intergenic
1006557822 6:34883975-34883997 AATCAGTTCACCATTGAGGAAGG + Intronic
1011637883 6:89391274-89391296 ACTCAGGAGACCAAGGTGGAAGG + Intronic
1012447281 6:99319490-99319512 AAACAGCAGGCAAATGTGGAGGG - Intronic
1012647320 6:101702311-101702333 AATCAGCAGACCCATGAAAAAGG + Intronic
1014174193 6:118314059-118314081 GAGCACCAGCCCAATGAGGATGG - Exonic
1014858614 6:126434291-126434313 AATCAGCAGTTAAATGATGAGGG + Intergenic
1015421629 6:133017168-133017190 CATCAGAAGCCCAATTAGGAAGG + Intergenic
1015933254 6:138383508-138383530 AATCAGAAGACAAATAAGCAAGG - Intergenic
1016411738 6:143790418-143790440 AAGGAGCAGACCCTTGAGGACGG + Intronic
1018468733 6:164078204-164078226 AATCAGAATCCCAAAGAGGAAGG - Intergenic
1019997405 7:4733750-4733772 AAACAGCAGACCCAAGAGCAAGG - Intronic
1021212940 7:17878801-17878823 AATCTGCATAACAAAGAGGAAGG - Intronic
1021652919 7:22848961-22848983 AATAAGCAGTTCATTGAGGAAGG + Intergenic
1021763384 7:23923235-23923257 AATCAGCAGAACAAGGAAAAGGG - Intergenic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1023415684 7:39930181-39930203 GATCAGCAGACATTTGAGGATGG - Intergenic
1023626969 7:42125357-42125379 CAGCAGCAGACCACGGAGGAAGG + Intronic
1023641947 7:42268176-42268198 ATTCAGCAGTCCAGTGAGAATGG - Intergenic
1024723326 7:52163521-52163543 AATCATCAGACAAATGAAGATGG + Intergenic
1024793270 7:52991734-52991756 AACCAGCAGAAAAATGAAGATGG + Intergenic
1025987896 7:66472002-66472024 AATCAGCAGTTCTCTGAGGAAGG - Intergenic
1027471208 7:78576580-78576602 CATCAGAAGACCACAGAGGAAGG + Intronic
1027510960 7:79079130-79079152 AAACAGCTGAGAAATGAGGAGGG - Intronic
1028536368 7:91892353-91892375 AGTTAGTAGAGCAATGAGGAAGG - Intergenic
1030214306 7:107028266-107028288 ACTCAGGAGGCCAATGAGGGAGG + Intergenic
1030977776 7:116148180-116148202 AAACAGGAGGCCAATGTGGATGG + Intronic
1032282504 7:130515786-130515808 AGTAAGCAGGCCAGTGAGGAAGG + Intronic
1032600681 7:133290911-133290933 CTTCAGCAGAACAATGAAGAGGG - Intronic
1032661240 7:133986145-133986167 AATCAGAATATCAATGAGCATGG + Intronic
1033660229 7:143397602-143397624 AAGCAGCAGCCCAAAGATGACGG + Exonic
1034107158 7:148500229-148500251 AATCATCAGACCAGTGAAAATGG + Intergenic
1035010362 7:155710556-155710578 AATCAGGAGACCAGGGAAGAAGG - Intronic
1037254450 8:16937093-16937115 ACTCAGGAGGCCAAGGAGGAAGG + Intergenic
1037644674 8:20782405-20782427 AACCAGCAGACCACTGGTGATGG - Intergenic
1038245117 8:25848185-25848207 AATCACCAGAGGAATGTGGAGGG + Intronic
1040586713 8:48750275-48750297 ACTCAGCAAAGCCATGAGGATGG + Intergenic
1041043348 8:53868454-53868476 AAACTGCAGACCAGTGAGGCCGG - Intronic
1047120885 8:121903303-121903325 AAGCAGAAGATCATTGAGGATGG + Intergenic
1047238195 8:123060979-123061001 AATCATACGACCAATGAGGGTGG + Intronic
1047503954 8:125464037-125464059 AATGAGCAGATTAATGAGCAGGG + Intergenic
1047748225 8:127861000-127861022 TATCAGTACACCAATGAGGAGGG - Intergenic
1048140927 8:131793543-131793565 CATCTGCAAACCAAGGAGGAAGG - Intergenic
1053209736 9:36217645-36217667 AATCAAAATACCAAAGAGGAAGG + Intronic
1055001314 9:71452242-71452264 AATCAAAGGACAAATGAGGAGGG + Intergenic
1057008837 9:91583908-91583930 GAACTGCAGACCCATGAGGATGG - Intronic
1059115461 9:111597091-111597113 AATCAGCAGACATGTGAGCAAGG + Intronic
1189752269 X:44234440-44234462 ACTTAGCACACCAATGAGTAAGG - Intronic
1194777847 X:97987768-97987790 CATCAGCAACCCTATGAGGAAGG - Intergenic
1196047643 X:111273088-111273110 AAACTGAAGACCAATGAGCATGG - Intergenic
1196071053 X:111522662-111522684 TATCAGCAGAGGAATGTGGAAGG - Intergenic
1196707617 X:118729167-118729189 AATCAGGAGACTAATGAGACGGG - Intronic
1197095125 X:122584901-122584923 AATCAGCAGATCAATAAGTGTGG - Intergenic
1199285396 X:146049444-146049466 AATCTCCAGAACTATGAGGATGG + Intergenic