ID: 1082108514

View in Genome Browser
Species Human (GRCh38)
Location 11:48245804-48245826
Sequence CAAGATAACCACAGCGAAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082108514_1082108520 10 Left 1082108514 11:48245804-48245826 CCCATTTCGCTGTGGTTATCTTG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1082108520 11:48245837-48245859 CCTGCGTCTTCAACTCTCTGAGG 0: 1
1: 0
2: 1
3: 9
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082108514 Original CRISPR CAAGATAACCACAGCGAAAT GGG (reversed) Exonic
909259136 1:73464321-73464343 TAAGATACCCACATCGAAATGGG - Intergenic
910080244 1:83333317-83333339 CAAGATAAAAACAAAGAAATCGG - Intergenic
912063367 1:105702894-105702916 AGAGATAACCACAGCAAAATGGG + Intergenic
913703119 1:121393440-121393462 CAAGAGAACTGCAGCTAAATTGG + Intergenic
913939784 1:125090491-125090513 CAAGAGAACTGCAGCTAAATTGG - Intergenic
913979291 1:143494604-143494626 CAAGAGAACTGCAGCTAAATTGG + Intergenic
914043681 1:144073938-144073960 CAAGAGAACTGCAGCTAAATTGG + Intergenic
914134406 1:144886553-144886575 CAAGAGAACTGCAGCTAAATTGG - Intergenic
920506885 1:206521573-206521595 AAAGATAAGGACAGCCAAATAGG - Intronic
1063294016 10:4783301-4783323 CCAGATAACACCAGCAAAATGGG + Intergenic
1066491109 10:35896090-35896112 TAAGATAAAGACAGCAAAATTGG + Intergenic
1066744815 10:38597556-38597578 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1066780353 10:38939297-38939319 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1066956098 10:42174579-42174601 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1068117078 10:52747264-52747286 GAAGATAAAGACAGTGAAATTGG + Intergenic
1071773534 10:88758106-88758128 AAAGATAACCACACTGTAATAGG + Intergenic
1074520177 10:114213413-114213435 CAAAATAATCACAGTGAAAGTGG + Exonic
1081411488 11:42763759-42763781 CAGGACTACCACAGTGAAATGGG + Intergenic
1082108514 11:48245804-48245826 CAAGATAACCACAGCGAAATGGG - Exonic
1082612575 11:55319279-55319301 CAAGATAACCACGGTAAAATGGG - Intergenic
1088233053 11:107692846-107692868 AAAGAAAACCACAGCCAGATGGG + Intergenic
1088364439 11:109024567-109024589 CAAGGTAACCAAAGCAAAAATGG - Intergenic
1092122370 12:6053492-6053514 CATGCCTACCACAGCGAAATGGG + Intronic
1094260759 12:28495996-28496018 CAATATAACCTCAGGAAAATCGG - Intronic
1101473632 12:105022724-105022746 CATGATAAACAGAGCGAATTTGG - Exonic
1105815626 13:24033677-24033699 CATGCTAAGCACAGCGAAGTAGG + Intronic
1110593290 13:77289576-77289598 CAAAATAACCACAGCTAACATGG + Intronic
1111713954 13:91853982-91854004 AAAAATAACCATAGTGAAATTGG - Intronic
1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG + Intronic
1112684103 13:101802992-101803014 CAAGACAACTAAAGCTAAATGGG - Intronic
1113821236 13:113214957-113214979 CAAGATGTCCACAGCCACATGGG - Intronic
1116515650 14:45801946-45801968 CAAAATAACCACATCAATATAGG - Intergenic
1121391081 14:93575309-93575331 AAAGATGAACACAGCGAGATGGG - Intronic
1202936899 14_KI270725v1_random:96806-96828 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1123392978 15:19896392-19896414 CAAGAGAACTACAGCTAAATTGG + Intergenic
1123396301 15:19940952-19940974 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1126192456 15:45892169-45892191 CAAAATAAGCACAGAAAAATAGG - Intergenic
1126192465 15:45892260-45892282 CAAAATAAGCACAGAAAAATAGG - Intergenic
1126315489 15:47365022-47365044 CAAGATAACAAAAGGGAAGTTGG + Intronic
1136698777 16:32113104-32113126 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1136738051 16:32481223-32481245 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1136768826 16:32814724-32814746 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1136799281 16:33056403-33056425 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1136901764 16:34047627-34047649 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1136956957 16:34799352-34799374 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1138742516 16:59327179-59327201 CAAGACAACCAAAGCAAAAATGG - Intergenic
1139087973 16:63611981-63612003 GAAGAAAACCTCAGAGAAATGGG - Intergenic
1140159222 16:72468689-72468711 CAAGACAAAAACAGAGAAATGGG + Intergenic
1203015022 16_KI270728v1_random:348354-348376 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1203033357 16_KI270728v1_random:621512-621534 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1203071244 16_KI270728v1_random:1076835-1076857 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1142918616 17:3164263-3164285 CAACATAACCACACCGAAAGGGG - Intergenic
1145692929 17:26763356-26763378 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1145709663 17:26959978-26960000 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1145981462 17:29014681-29014703 AAAGATAAGCACATGGAAATAGG + Intronic
1148844321 17:50519890-50519912 CCAGAGAACCACAGAGAAACAGG - Intronic
1154518604 18:15200773-15200795 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1156788361 18:40942612-40942634 CAAGATATCCACAGAATAATGGG + Intergenic
1156829002 18:41468121-41468143 GAAGATAACTACAGAGAAAGTGG - Intergenic
1157824556 18:50801098-50801120 CAAGATAAGCTCAGGGTAATGGG - Intronic
1202682922 1_KI270712v1_random:26270-26292 CAAGAGAACTGCAGCTAAATTGG + Intergenic
927062705 2:19439536-19439558 CAAGATGACCACAGTGATCTAGG - Intergenic
930335596 2:50041366-50041388 CTAGAAAACCAGATCGAAATAGG - Intronic
930670778 2:54148026-54148048 CAAGACAACCACAGAGACATTGG - Intronic
932633549 2:73367979-73368001 CCAGATAATCAAAGGGAAATAGG + Intergenic
934189237 2:89770507-89770529 CAAGAGAACTGCAGCTAAATTGG - Intergenic
934248875 2:90328904-90328926 CAAGAGAACTGCAGCTAAATTGG - Intergenic
934260704 2:91474576-91474598 CAAGAGAACTGCAGCTAAATTGG + Intergenic
934304023 2:91806522-91806544 CAAGAGAACTGCAGCTAAATTGG + Intergenic
934329231 2:92046228-92046250 CAAGAGAACTGCAGCTAAATTGG - Intergenic
936789412 2:116133409-116133431 TAAAATAACCACAGAGAAATTGG - Intergenic
937022700 2:118672876-118672898 CAAGATGACCATTGCGAAAAAGG + Intergenic
938518593 2:132041261-132041283 CAAGAGAACTGCAGCTAAATTGG - Intergenic
944697870 2:202219012-202219034 TAAGATAATCACAGAAAAATGGG + Intronic
945630101 2:212263976-212263998 CAACATGACCACAGCAATATAGG - Intronic
948234053 2:236374095-236374117 CAAAATAACCAGAGAGCAATGGG - Intronic
1172363237 20:34329543-34329565 CAAGAGAATCACAGAGACATTGG - Intergenic
1174760759 20:53205216-53205238 CAAGAAAAACACAGAGAATTTGG + Intronic
1176743122 21:10624889-10624911 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1176995261 21:15548135-15548157 CAAGGTGACTACAGGGAAATAGG + Intergenic
1180281061 22:10696351-10696373 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1182025600 22:27115911-27115933 CAAGGTAAACACAGCGATATTGG + Intergenic
1182245185 22:28951680-28951702 CAAGAGAACCACAGGGCCATGGG - Intronic
1203289505 22_KI270735v1_random:20564-20586 CAAGAGAACTGCAGCTAAATTGG - Intergenic
949797891 3:7870667-7870689 CAAAATTACCACAGAGAATTAGG - Intergenic
951647893 3:24914007-24914029 AAAGGTAGCCACAGGGAAATGGG + Intergenic
957818374 3:85333844-85333866 CAATATAACAACAGGAAAATTGG - Intronic
957895357 3:86414465-86414487 CTAGATAACAATAGCTAAATTGG + Intergenic
962003800 3:131327850-131327872 CAAAATAAAAACAGGGAAATAGG - Intronic
969114646 4:4863498-4863520 CAAGAAAAGCGCAGAGAAATCGG + Exonic
969372230 4:6740461-6740483 CAGGACAACCACAGAAAAATTGG - Intergenic
975211576 4:71706713-71706735 CAAGCTGACCACAGCAAAAGAGG - Intergenic
975222103 4:71824361-71824383 CAAGAAAATCACAGAGAAAATGG + Intergenic
988499057 5:31768869-31768891 CAGTATTACCACAGCGAAGTTGG - Intronic
988958611 5:36346415-36346437 CCTGATAACAACAGCAAAATGGG - Intergenic
1011900044 6:92282451-92282473 CAAAATAAACACAAAGAAATTGG - Intergenic
1013121949 6:107149164-107149186 CAAGATAACCCAAGAGAATTTGG + Intergenic
1013426949 6:110020933-110020955 CAAGATGACCACAGAAAAACAGG - Intergenic
1013847255 6:114467973-114467995 CAACAAAACCTCAGGGAAATAGG + Intergenic
1024804671 7:53124095-53124117 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1025307218 7:57871893-57871915 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1025481470 7:60989284-60989306 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1025838500 7:65120562-65120584 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1029165262 7:98584741-98584763 CAGCATAACCACACTGAAATAGG - Intergenic
1034245077 7:149637834-149637856 CAAGAGATCCTCAGAGAAATGGG - Intergenic
1038679899 8:29657097-29657119 CAAGATAAAGACATCTAAATAGG - Intergenic
1039024019 8:33238247-33238269 CAAAATAACCAGAGAGAACTGGG + Intergenic
1040772608 8:50996330-50996352 CATGACAACCAGAGCGCAATAGG + Intergenic
1040938725 8:52810535-52810557 CAAGATAACCACAACATAAATGG - Intergenic
1042624774 8:70745704-70745726 CAATGGAACCACAGAGAAATTGG + Intronic
1048627478 8:136201159-136201181 GAAGAGAAACACAGCAAAATAGG - Intergenic
1053697867 9:40654235-40654257 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1053943875 9:43284431-43284453 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1054309158 9:63453643-63453665 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1054407953 9:64777761-64777783 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1054441100 9:65261591-65261613 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1054489177 9:65759898-65759920 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1059088196 9:111327687-111327709 CAAAATCACCACAGTCAAATGGG + Exonic
1202780230 9_KI270717v1_random:27429-27451 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1203582289 Un_KI270746v1:20598-20620 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1203587010 Un_KI270747v1:13008-13030 CAAGAGAACTGCAGCTAAATTGG - Intergenic
1203616318 Un_KI270749v1:69681-69703 CAAGAGAACTGCAGCTAAATTGG + Intergenic
1187699581 X:21952296-21952318 CAAGATAAACACACAAAAATGGG - Intronic
1192279832 X:69672912-69672934 AAAGAAAACCACAGCAAGATTGG + Intronic
1195619902 X:106942553-106942575 GAAGAGAACCACAGAAAAATTGG - Exonic
1199340026 X:146666745-146666767 CATGATAACCTCAGCCAACTAGG + Intergenic
1201194997 Y:11484153-11484175 CAAGAGAACTGCAGCTAAATTGG - Intergenic