ID: 1082114571

View in Genome Browser
Species Human (GRCh38)
Location 11:48314418-48314440
Sequence GTAGAGAAGGAGACAGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082114571_1082114576 -10 Left 1082114571 11:48314418-48314440 CCTACCCCTGTCTCCTTCTCTAC No data
Right 1082114576 11:48314431-48314453 CCTTCTCTACCTCCTCTTTAAGG 0: 10
1: 162
2: 344
3: 495
4: 724
1082114571_1082114579 20 Left 1082114571 11:48314418-48314440 CCTACCCCTGTCTCCTTCTCTAC No data
Right 1082114579 11:48314461-48314483 TTCTTAGATTTGCCCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082114571 Original CRISPR GTAGAGAAGGAGACAGGGGT AGG (reversed) Intergenic
No off target data available for this crispr