ID: 1082119020

View in Genome Browser
Species Human (GRCh38)
Location 11:48357955-48357977
Sequence CCATTGATTCAGAGGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082119020_1082119029 20 Left 1082119020 11:48357955-48357977 CCTTGCACCCTCTGAATCAATGG No data
Right 1082119029 11:48357998-48358020 CTTTTAGCCATGACTAGAGCTGG No data
1082119020_1082119030 25 Left 1082119020 11:48357955-48357977 CCTTGCACCCTCTGAATCAATGG No data
Right 1082119030 11:48358003-48358025 AGCCATGACTAGAGCTGGAGTGG No data
1082119020_1082119024 -6 Left 1082119020 11:48357955-48357977 CCTTGCACCCTCTGAATCAATGG No data
Right 1082119024 11:48357972-48357994 CAATGGCCTGATCTGTACTTTGG No data
1082119020_1082119032 29 Left 1082119020 11:48357955-48357977 CCTTGCACCCTCTGAATCAATGG No data
Right 1082119032 11:48358007-48358029 ATGACTAGAGCTGGAGTGGCTGG No data
1082119020_1082119033 30 Left 1082119020 11:48357955-48357977 CCTTGCACCCTCTGAATCAATGG No data
Right 1082119033 11:48358008-48358030 TGACTAGAGCTGGAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082119020 Original CRISPR CCATTGATTCAGAGGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr