ID: 1082123182

View in Genome Browser
Species Human (GRCh38)
Location 11:48402541-48402563
Sequence AAGAACAAGCACAAGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082123178_1082123182 5 Left 1082123178 11:48402513-48402535 CCAAAATCAAACAAAGATATCAT No data
Right 1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG No data
1082123177_1082123182 12 Left 1082123177 11:48402506-48402528 CCTCATGCCAAAATCAAACAAAG No data
Right 1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG No data
1082123176_1082123182 13 Left 1082123176 11:48402505-48402527 CCCTCATGCCAAAATCAAACAAA No data
Right 1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082123182 Original CRISPR AAGAACAAGCACAAGGGGTC AGG Intergenic
No off target data available for this crispr