ID: 1082127184

View in Genome Browser
Species Human (GRCh38)
Location 11:48447188-48447210
Sequence AAAAAGAAAACTTGTCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082127184_1082127186 24 Left 1082127184 11:48447188-48447210 CCTGGCCGACAAGTTTTCTTTTT No data
Right 1082127186 11:48447235-48447257 ATGACTACTCAAGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082127184 Original CRISPR AAAAAGAAAACTTGTCGGCC AGG (reversed) Intergenic
No off target data available for this crispr