ID: 1082131458

View in Genome Browser
Species Human (GRCh38)
Location 11:48494846-48494868
Sequence ATTGTCTGTGTTGCTAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082131458_1082131461 16 Left 1082131458 11:48494846-48494868 CCATAGTTAGCAACACAGACAAT No data
Right 1082131461 11:48494885-48494907 CAGATGGGACATCATTTATGAGG No data
1082131458_1082131459 0 Left 1082131458 11:48494846-48494868 CCATAGTTAGCAACACAGACAAT No data
Right 1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG No data
1082131458_1082131460 1 Left 1082131458 11:48494846-48494868 CCATAGTTAGCAACACAGACAAT No data
Right 1082131460 11:48494870-48494892 TGTGTATTTGAAGAGCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082131458 Original CRISPR ATTGTCTGTGTTGCTAACTA TGG (reversed) Intergenic
No off target data available for this crispr