ID: 1082131459 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:48494869-48494891 |
| Sequence | CTGTGTATTTGAAGAGCAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082131458_1082131459 | 0 | Left | 1082131458 | 11:48494846-48494868 | CCATAGTTAGCAACACAGACAAT | No data | ||
| Right | 1082131459 | 11:48494869-48494891 | CTGTGTATTTGAAGAGCAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082131459 | Original CRISPR | CTGTGTATTTGAAGAGCAGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||