ID: 1082131459

View in Genome Browser
Species Human (GRCh38)
Location 11:48494869-48494891
Sequence CTGTGTATTTGAAGAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082131458_1082131459 0 Left 1082131458 11:48494846-48494868 CCATAGTTAGCAACACAGACAAT No data
Right 1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082131459 Original CRISPR CTGTGTATTTGAAGAGCAGA TGG Intergenic
No off target data available for this crispr