ID: 1082134754

View in Genome Browser
Species Human (GRCh38)
Location 11:48534316-48534338
Sequence CTGAAAACACAGAAGTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082134754_1082134760 27 Left 1082134754 11:48534316-48534338 CCCAGTTACTTCTGTGTTTTCAG No data
Right 1082134760 11:48534366-48534388 TCTAACTGTCATCTAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082134754 Original CRISPR CTGAAAACACAGAAGTAACT GGG (reversed) Intergenic
No off target data available for this crispr