ID: 1082146114

View in Genome Browser
Species Human (GRCh38)
Location 11:48671569-48671591
Sequence AAGAAACTGTTAACTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082146114_1082146116 8 Left 1082146114 11:48671569-48671591 CCTTGCAGAGTTAACAGTTTCTT No data
Right 1082146116 11:48671600-48671622 GCAGTCTGGAAACACTGTTTTGG No data
1082146114_1082146117 22 Left 1082146114 11:48671569-48671591 CCTTGCAGAGTTAACAGTTTCTT No data
Right 1082146117 11:48671614-48671636 CTGTTTTGGCAGAATCTGTGAGG No data
1082146114_1082146119 24 Left 1082146114 11:48671569-48671591 CCTTGCAGAGTTAACAGTTTCTT No data
Right 1082146119 11:48671616-48671638 GTTTTGGCAGAATCTGTGAGGGG No data
1082146114_1082146118 23 Left 1082146114 11:48671569-48671591 CCTTGCAGAGTTAACAGTTTCTT No data
Right 1082146118 11:48671615-48671637 TGTTTTGGCAGAATCTGTGAGGG No data
1082146114_1082146115 -6 Left 1082146114 11:48671569-48671591 CCTTGCAGAGTTAACAGTTTCTT No data
Right 1082146115 11:48671586-48671608 TTTCTTTGTATACAGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082146114 Original CRISPR AAGAAACTGTTAACTCTGCA AGG (reversed) Intergenic
No off target data available for this crispr