ID: 1082146117

View in Genome Browser
Species Human (GRCh38)
Location 11:48671614-48671636
Sequence CTGTTTTGGCAGAATCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082146114_1082146117 22 Left 1082146114 11:48671569-48671591 CCTTGCAGAGTTAACAGTTTCTT No data
Right 1082146117 11:48671614-48671636 CTGTTTTGGCAGAATCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082146117 Original CRISPR CTGTTTTGGCAGAATCTGTG AGG Intergenic
No off target data available for this crispr