ID: 1082150530

View in Genome Browser
Species Human (GRCh38)
Location 11:48733721-48733743
Sequence AAGCACTCACAAATATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082150530_1082150534 29 Left 1082150530 11:48733721-48733743 CCATGGGATATTTGTGAGTGCTT No data
Right 1082150534 11:48733773-48733795 TCACCTATAAACTATAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082150530 Original CRISPR AAGCACTCACAAATATCCCA TGG (reversed) Intergenic
No off target data available for this crispr