ID: 1082150534

View in Genome Browser
Species Human (GRCh38)
Location 11:48733773-48733795
Sequence TCACCTATAAACTATAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082150530_1082150534 29 Left 1082150530 11:48733721-48733743 CCATGGGATATTTGTGAGTGCTT No data
Right 1082150534 11:48733773-48733795 TCACCTATAAACTATAAAGAAGG No data
1082150533_1082150534 1 Left 1082150533 11:48733749-48733771 CCTATGGTGATAAAGAAAATATC No data
Right 1082150534 11:48733773-48733795 TCACCTATAAACTATAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082150534 Original CRISPR TCACCTATAAACTATAAAGA AGG Intergenic
No off target data available for this crispr