ID: 1082166396

View in Genome Browser
Species Human (GRCh38)
Location 11:48955580-48955602
Sequence AGTGGGGGGCAGCCCCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1643
Summary {0: 6, 1: 271, 2: 425, 3: 324, 4: 617}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166396_1082166416 29 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data
1082166396_1082166409 0 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166409 11:48955603-48955625 TCCCGGAAGGGGCGGGTGCTGGG No data
1082166396_1082166405 -7 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166405 11:48955596-48955618 CCCCACTTCCCGGAAGGGGCGGG No data
1082166396_1082166408 -1 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166408 11:48955602-48955624 TTCCCGGAAGGGGCGGGTGCTGG No data
1082166396_1082166403 -8 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166403 11:48955595-48955617 CCCCCACTTCCCGGAAGGGGCGG No data
1082166396_1082166412 6 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166412 11:48955609-48955631 AAGGGGCGGGTGCTGGGCAGAGG No data
1082166396_1082166415 28 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166415 11:48955631-48955653 GGTCTCCTCACTTCCCAGAAGGG No data
1082166396_1082166413 7 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166396_1082166414 27 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166414 11:48955630-48955652 GGGTCTCCTCACTTCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166396 Original CRISPR AGTGGGGGGCAGCCCCCGCC CGG (reversed) Intergenic
900293698 1:1937619-1937641 ACTGGGGGGCAGTCACAGCCGGG - Intronic
900326867 1:2112520-2112542 TGTGGGGTGCAGCCGCCGCTTGG + Intronic
900330624 1:2132823-2132845 AAGCGGGGTCAGCCCCCGCCTGG + Intronic
900382635 1:2392222-2392244 CGAGGGCTGCAGCCCCCGCCCGG - Intronic
900601912 1:3506339-3506361 AGCTGGGAGCAGCCCCCGCCAGG + Intronic
900989047 1:6089575-6089597 AGTGGGTGGCTTGCCCCGCCAGG - Intronic
901100362 1:6715123-6715145 GGGGGGGGTCAGCCCCCGTCCGG - Intergenic
901734773 1:11305671-11305693 GGTGGGGGCCAGCCCCCGTCCGG - Intergenic
901849849 1:12008409-12008431 GGGGGGGGTCAGCCCCCGCCCGG - Intronic
901970350 1:12902987-12903009 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
902014815 1:13298782-13298804 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
902189990 1:14755669-14755691 TGTGGAGGGCAGCCCCTTCCTGG + Intronic
902629704 1:17697309-17697331 AGTGGGAGGCAGGCCCCGTGTGG + Exonic
902754078 1:18537632-18537654 AGTGAGGAGCAGCCCCCACCAGG - Intergenic
903103559 1:21053719-21053741 TTGGGGGGTCAGCCCCCGCCCGG + Intronic
903162947 1:21502657-21502679 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
903162970 1:21502704-21502726 GGTGGGAGTCAGCCCCCGCCCGG - Intergenic
903383040 1:22909893-22909915 GGTGGGAGGGAGCCCCAGCCAGG + Intronic
903508189 1:23853342-23853364 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
903519467 1:23935858-23935880 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
903525048 1:23987157-23987179 GGTGGGGGTCAGCCCCCACCCGG - Intergenic
903748469 1:25604049-25604071 GGGGGGGGTCAGCCCCCGCCAGG + Intergenic
903894996 1:26596825-26596847 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
904000300 1:27335158-27335180 AGCGCGGAGCAGCCCCTGCCCGG + Intronic
904029101 1:27522980-27523002 AGGGGGGGCCAGCCCCAGCTCGG + Intergenic
904074358 1:27829151-27829173 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
904607089 1:31704005-31704027 AGTGGCCGGCAGTCCCCGGCAGG - Exonic
904760959 1:32804360-32804382 GGTGGGGGGCAACCCCCGCCCGG - Intronic
904760978 1:32804406-32804428 GGTGGGGGGCAGCCGCCGCCCGG - Intronic
904831585 1:33309384-33309406 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
904831607 1:33309430-33309452 CGTGGGGGACAGCCCCCGCCTGG - Intronic
904831628 1:33309476-33309498 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
904838784 1:33356908-33356930 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
904857282 1:33509263-33509285 GGGGGGGGTCAGCCCCTGCCCGG - Intergenic
904930379 1:34082411-34082433 AGGTGGGGGGCGCCCCCGCCTGG + Intronic
905230895 1:36514438-36514460 AGTGGGGGGCTGACCCCTGCAGG - Intergenic
905315639 1:37080685-37080707 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
905527087 1:38647595-38647617 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
905527109 1:38647642-38647664 GTGGGGGGTCAGCCCCCGCCAGG + Intergenic
905680879 1:39869888-39869910 GGTGGGGGACAGCCTCTGCCCGG + Intronic
905956518 1:42001894-42001916 ACTGGGGGGTAGCCCGGGCCTGG + Intronic
906083087 1:43107407-43107429 AGTGGGGGGCAGTGCTCGTCGGG + Intergenic
906140814 1:43532347-43532369 AGAGGGAGGCTGCCCCAGCCTGG + Intronic
906432393 1:45765677-45765699 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
906486814 1:46241051-46241073 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
906740107 1:48174358-48174380 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
906740130 1:48174400-48174422 GGTGGGGGGCAGCCCCCGACAGG + Intergenic
906740147 1:48174442-48174464 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
906740168 1:48174484-48174506 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
906770642 1:48479564-48479586 GGTGGGGGTCAGCCCCTGCCAGG + Intergenic
907037537 1:51229558-51229580 AGTGTGGGGTAACCCCCTCCAGG + Intergenic
907140601 1:52181949-52181971 GGTGGGGGTCAGCCACCGCCAGG + Intronic
907202852 1:52742887-52742909 TCTGGGGGGCAGCCCCCGCCCGG + Intronic
907202875 1:52742933-52742955 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
908086518 1:60640736-60640758 ACTGGGAGGCACCCCCCGGCAGG + Intergenic
909893323 1:81035382-81035404 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
909893343 1:81035424-81035446 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
910406912 1:86899677-86899699 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
910412650 1:86963778-86963800 GGTGGGGGCCAGCCCCCACCCGG - Intronic
910412674 1:86963825-86963847 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
910412704 1:86963888-86963910 GGTGGGGGGCAGCCCCCGCCAGG - Intronic
910802594 1:91160805-91160827 AGTTGGTGGCAGCCGGCGCCAGG - Intergenic
910815703 1:91289035-91289057 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
910891595 1:92025973-92025995 GGTGGGGGGCAGGCCCTGCCGGG - Intergenic
910891620 1:92026019-92026041 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
911325829 1:96469762-96469784 GGTGGGGGTCAGCCCCCTCCAGG - Intergenic
911351758 1:96762708-96762730 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
911486567 1:98512578-98512600 TGTGGGGGTCAGCCCCCGCCCGG - Intergenic
911598598 1:99823741-99823763 GGTGGGGGTCAGCCCCCACCCGG + Intergenic
912298485 1:108489916-108489938 GGGGGGGGTCAGCCCCCGCCCGG - Intergenic
912302959 1:108536143-108536165 GGTGGGGGTCAGCCCCCGCCCGG - Intergenic
912355809 1:109053510-109053532 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
912355828 1:109053556-109053578 GGTCGTGGGCAACCCCCGCCCGG + Intergenic
912668977 1:111607855-111607877 GGGGGGGGTCAGGCCCCGCCCGG - Intronic
912669051 1:111608030-111608052 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
912844006 1:113063547-113063569 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
912990260 1:114479814-114479836 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
913022744 1:114804442-114804464 CGGGGGCGGCAGCCCCCGCCCGG - Intergenic
913022791 1:114804544-114804566 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
913054855 1:115148537-115148559 ACTGGGAGGCACCCCCCACCAGG + Intergenic
913109350 1:115642924-115642946 AGTGGGGCGGAGCCGCGGCCTGG + Intronic
913434464 1:118832159-118832181 ACTGGGGGGCACCCCCCGGTAGG + Intergenic
914002308 1:143703290-143703312 TGGGGGGGTCAGACCCCGCCCGG + Intergenic
914086265 1:144456657-144456679 AGTTGGTGGCAGCCCCAGCGTGG + Exonic
914231001 1:145764707-145764729 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
914374639 1:147062147-147062169 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
914392202 1:147233325-147233347 GGTGGGGATCAGCCCCTGCCAGG + Intronic
914788001 1:150851147-150851169 GGTGGGGGGCAGCCCCCGCCTGG + Intronic
914788019 1:150851193-150851215 GGCGGGGGCCAGCCCCCGCCCGG + Intronic
914908949 1:151769276-151769298 GGTGGGGGGCAGTCCCCACCCGG - Intronic
914908970 1:151769322-151769344 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
914953890 1:152144760-152144782 GGTGGGGGGAAGCCCCCACCCGG - Intergenic
914953910 1:152144805-152144827 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
914953932 1:152144851-152144873 GGTTGGGGGCAGCCCCCACCTGG - Intergenic
914965773 1:152256252-152256274 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
914987315 1:152472022-152472044 GTGGGGGGTCAGCCCCCGCCTGG - Intergenic
915581363 1:156815060-156815082 AGCACGGGGCAGCCCCTGCCTGG - Exonic
915657404 1:157372809-157372831 AGCGGGGGTCAGTCCCCACCAGG + Intergenic
916037390 1:160933490-160933512 GGTGGGGGGCAGCCCCTGCCCGG + Intergenic
916037880 1:160936810-160936832 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
916037903 1:160936857-160936879 GGTGGGGGTCAGCCCCCGCCCGG - Intergenic
916037923 1:160936903-160936925 GGTGGGGGGCAGCACCCGCCTGG - Intergenic
916050080 1:161029783-161029805 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
916050101 1:161029825-161029847 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
916087429 1:161281503-161281525 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
916087451 1:161281550-161281572 GGTGGGGATCAGCCCCCGCCCGG - Intronic
916087470 1:161281596-161281618 GGTGGGGGTCAGCCCCCTCCTGG - Intronic
916105022 1:161423627-161423649 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
916864149 1:168837498-168837520 GGTGGGGGGCAGCCCCCGCCTGG + Intergenic
917126587 1:171693800-171693822 GTGGGGGGTCAGCCCCCGCCTGG - Intergenic
917126610 1:171693847-171693869 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
917126633 1:171693894-171693916 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
917206063 1:172572076-172572098 GTGGGGGGTCAGCCCCCGCCTGG + Intronic
917304641 1:173613457-173613479 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
917304732 1:173613646-173613668 GAGGGGGGTCAGCCCCCGCCTGG + Intronic
917396070 1:174595634-174595656 ACTGGGAGGCAGCCCCCAGCAGG - Intronic
917553327 1:176058083-176058105 TGGGGAGGTCAGCCCCCGCCCGG + Intronic
917553356 1:176058138-176058160 GGGGGGGGTCAGCCCCCGCCCGG + Intronic
917848376 1:179040697-179040719 GTGGGGGGTCAGCCCCCGCCAGG - Intronic
917848398 1:179040744-179040766 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
918022716 1:180710864-180710886 GGTGGGGGGCAGCCCCCACCCGG - Intronic
918166548 1:181954869-181954891 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
918172504 1:182011049-182011071 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
918172527 1:182011095-182011117 GGTGGGGGGCAGCCCTTGCCCGG + Intergenic
918172548 1:182011141-182011163 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
918818863 1:189225950-189225972 GGTTGGGGGCAGCCCCCGCCCGG + Intergenic
919423918 1:197405903-197405925 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
919625235 1:199904509-199904531 GGTGGGGGTCAGCCCCCACCCGG - Intergenic
919812027 1:201414711-201414733 AGGGGAGGGCAGCCACAGCCTGG + Intronic
919959417 1:202451835-202451857 GGTGGGGGTCAGCCCCCACCAGG - Intronic
920034509 1:203057051-203057073 AGTTGGGGGAAGCCCCAGGCAGG + Intronic
920065532 1:203266782-203266804 GATGGGGGGGCGCCCCCGCCCGG - Intronic
920067204 1:203277370-203277392 GGTGGGAGGCAGCCCGTGCCTGG + Intergenic
921016538 1:211197337-211197359 GCCGGGGGGCAGCCCCCGCCCGG + Intergenic
921109116 1:212015084-212015106 GGTGGGGGGCGGCCCCCGCCCGG + Intronic
921109139 1:212015130-212015152 GGTGGGGGGCAGCCCCTGCCCGG + Intronic
921177587 1:212608027-212608049 AGCGGAGGGCAGCCCTCGGCTGG - Intronic
921192810 1:212725052-212725074 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
921192832 1:212725098-212725120 GGTGGGGGGCAGCCCCTGCCCGG + Intergenic
922306498 1:224349834-224349856 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
922496504 1:226062238-226062260 AGGGAGGGGCTGCCCCCGCGCGG - Intronic
922632851 1:227133037-227133059 GGTGGGGGTCAGCCCCCACCAGG + Intronic
922644921 1:227276449-227276471 GTCGGGGGGCAGCCCCCGCTCGG + Intronic
922644939 1:227276491-227276513 GGTGGGGGGCAGCCCCCTCCCGG + Intronic
922693171 1:227711021-227711043 GGTGGGGGTCACCCCCCGCCTGG - Intergenic
923087709 1:230713927-230713949 AGTGGGGGAAAGCCCGCGTCCGG + Intronic
924692288 1:246363248-246363270 GGTGGGGGTTAGCCCCCGCCAGG + Intronic
924766018 1:247032431-247032453 GGTGGGGGTCAGCCCCCGCCCGG + Intergenic
924766100 1:247032619-247032641 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
924766122 1:247032666-247032688 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
924824184 1:247522248-247522270 GGTGGGGGGCAGCCCCCACCCGG + Intronic
1063459547 10:6206570-6206592 TGGGGGGGTCAGCCCCTGCCCGG - Intronic
1063776702 10:9273232-9273254 GGTGGGGGGCAACCCCCGCCGGG - Intergenic
1063822703 10:9855694-9855716 GGTGGGGGGCAGCCCCTGCCCGG - Intergenic
1063822723 10:9855736-9855758 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1064070685 10:12226344-12226366 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1064070707 10:12226390-12226412 GGTGGGGGAGAGCCCCCACCCGG - Intronic
1064109040 10:12522860-12522882 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1064109063 10:12522907-12522929 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1065055380 10:21837777-21837799 GGTAGGGGGCAGCCCCCGCCCGG + Intronic
1065055403 10:21837823-21837845 GGTGGGGGGCAGCCCCCGCCTGG + Intronic
1065055425 10:21837869-21837891 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1065055446 10:21837915-21837937 GGTGGCGGGCAGCCCCCGCCCGG + Intronic
1065055470 10:21837961-21837983 GGTGGGGGGCAGTCCCCGCCCGG + Intronic
1065336353 10:24657247-24657269 TGGGGGGGTCAGCCCCCGGCCGG + Intronic
1065636736 10:27742555-27742577 AGTGGAGGGCAGGCTCTGCCTGG - Intronic
1065738095 10:28772042-28772064 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1066086822 10:31979308-31979330 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1066086837 10:31979340-31979362 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
1066115241 10:32233564-32233586 GGTGGAGGGCAGCCCCCGCCCGG - Intergenic
1066140485 10:32500219-32500241 GTCGGGGGGCAGCCCCCGCCAGG - Intronic
1066325381 10:34353127-34353149 AGTGGGGGGCAGCCCCCGCCCGG + Intronic
1066676978 10:37897696-37897718 ACTGGGAGGCAACCCCCACCAGG + Intergenic
1066697908 10:38094832-38094854 GGTGGGGGGAAGCGCCCGCGGGG + Intronic
1066952919 10:42138329-42138351 GGTGGGGGTCAGCCCCTGCCCGG + Intergenic
1067026479 10:42847488-42847510 GGTGGGGGTCAGCCCCTGCCAGG + Intergenic
1067034186 10:42900603-42900625 GGTGGGGGGCAGACCCCTCCCGG + Intergenic
1067034206 10:42900649-42900671 GTTGGGGGCCAGCCCCTGCCCGG + Intergenic
1067120027 10:43465277-43465299 GGTGGGGATCAGCCCCCGCCAGG - Intronic
1067238750 10:44472917-44472939 AGTGGGTGCCAGCCCCCGGGAGG + Intergenic
1067325203 10:45260100-45260122 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1067354519 10:45512347-45512369 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1067391204 10:45865495-45865517 GTGGGGGGGCAGCCCCCGCCTGG - Intergenic
1067685702 10:48465073-48465095 AGGCGGGGGCAGGCCCTGCCAGG - Intronic
1067872075 10:49970616-49970638 GTGGGGGGGCAGCCCCCGCCCGG + Intronic
1068673276 10:59744485-59744507 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1069157804 10:65052294-65052316 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1069424849 10:68279677-68279699 GTGGGGGGACAGCCCCCGCCCGG + Intergenic
1069744497 10:70706492-70706514 AGAGGAGGGCAGCCCCCAGCAGG - Intronic
1069910860 10:71758337-71758359 AGTGGGGACCAGCCCCTGCTAGG - Intronic
1070138363 10:73715637-73715659 GGCGGGGGGCAGCCCCCACCTGG - Intergenic
1070147650 10:73786214-73786236 AGTCGGGGACAGCTCCCGGCCGG - Intronic
1070367330 10:75750244-75750266 GGAGGTGGGCAGCCCCCGCCCGG - Intronic
1070367350 10:75750287-75750309 GGTGGGGGGCAGCCCCTGCCCGG - Intronic
1070629658 10:78075917-78075939 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1070684108 10:78468773-78468795 GGTAGGGGTCAGCCCCCGCCAGG - Intergenic
1070758050 10:79005697-79005719 GGTGGGTGGCTGCCACCGCCTGG + Intergenic
1070767968 10:79067347-79067369 AAGGGGGCGCAGCCCCGGCCGGG - Intergenic
1070807453 10:79279053-79279075 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1070807470 10:79279095-79279117 GGTGGGGGGCAGCCCCTGTCCGG - Intronic
1070807490 10:79279137-79279159 GGTCGGGGGCAGCCCCCGTCCGG - Intronic
1071311378 10:84347447-84347469 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1071311423 10:84347541-84347563 GGTGGGAGGCAGCCCCCGCCCGG - Intronic
1071311441 10:84347587-84347609 GGTGAGGGTCAGCCCCCGCCAGG - Intronic
1071476777 10:86032204-86032226 GTGGGGGGGCAGCCCCCGCCCGG + Intronic
1071509157 10:86250556-86250578 ACTGGGGGGCAGCCCCCGCCCGG + Intronic
1071509175 10:86250598-86250620 GGTGGGGGGCAGCCCCCGCCTGG + Intronic
1071509192 10:86250640-86250662 GGTGGGGGGCAGCCCCCGCCTGG + Intronic
1071538339 10:86455018-86455040 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1071538362 10:86455064-86455086 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1072013413 10:91323379-91323401 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1072684600 10:97528934-97528956 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1072730359 10:97841795-97841817 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1072772493 10:98152990-98153012 GGTGGGGGCCCGCCTCCGCCCGG + Intronic
1073238230 10:102036113-102036135 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1073238253 10:102036160-102036182 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1073238275 10:102036207-102036229 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1073450720 10:103607401-103607423 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1074043680 10:109817710-109817732 ACTGGGAGGCACCCCCCACCAGG - Intergenic
1074151923 10:110766943-110766965 TGGGGGGGTCACCCCCCGCCCGG - Intronic
1074151977 10:110767069-110767091 TGGGGGGGTCACCCCCCGCCCGG - Intronic
1074152120 10:110767378-110767400 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1074693544 10:116028236-116028258 AGTAGGGGGCAGGCCAGGCCAGG + Intergenic
1075181407 10:120215132-120215154 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1075243408 10:120798726-120798748 TGGGGGGGGCAGCCCCCGCCCGG + Intergenic
1075842802 10:125518555-125518577 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1075842824 10:125518603-125518625 TGGGGGGGACAGCGCCCGCCCGG + Intergenic
1076600540 10:131654464-131654486 AGTAGGGGCCAGCCCATGCCAGG - Intergenic
1076696076 10:132248023-132248045 AGGGTGGGGCAGCTGCCGCCTGG - Intronic
1076697746 10:132255324-132255346 AGTGGGGGGCACCCATTGCCAGG - Intronic
1076797572 10:132805673-132805695 GCTGGGGGGCAGCCCCCAGCCGG + Intergenic
1076822042 10:132944230-132944252 AGTGGGGGGCACCACCCTCCTGG + Intergenic
1077015022 11:395583-395605 AGTGGGGGCACGCCCCAGCCTGG - Intronic
1077668783 11:4138062-4138084 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1077680778 11:4237957-4237979 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1077690121 11:4334535-4334557 GGTGGGTGGCAGCCCCCTCCCGG - Intergenic
1077839699 11:5961087-5961109 GCTGGGGGGCAGCCCGCGCCCGG + Intergenic
1077839718 11:5961129-5961151 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1078122454 11:8523657-8523679 GGTGGGGGGCAGCCCCCGCCAGG + Intronic
1078129455 11:8601402-8601424 AGTGAGGGGCAAGCCCAGCCAGG + Intergenic
1078905746 11:15686417-15686439 GGTGGGGAGCAGCCCCCGCCCGG - Intergenic
1079018377 11:16888261-16888283 GGTGGGGGGCAGTCCCTGCCCGG + Intronic
1079444859 11:20548616-20548638 GGGGGGGGTCAACCCCCGCCCGG + Intergenic
1079479269 11:20863354-20863376 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1080538421 11:33243908-33243930 GGTGGGGGGCAGCCCCCACCTGG + Intergenic
1080538441 11:33243954-33243976 GGTCGGGGGCAGTCCCCACCCGG + Intergenic
1080620891 11:33986325-33986347 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1080835291 11:35935065-35935087 AGTTGGGGGCTGACCCCCCCGGG - Intergenic
1082065138 11:47893153-47893175 GGTTGGGGGCAGCCCCCGCCCGG + Intergenic
1082166355 11:48955492-48955514 GGTGGGGGGCAGCCCCTGCCCGG - Intergenic
1082166373 11:48955534-48955556 GGTGGGGGGCAGCCCCCGTCCGG - Intergenic
1082166396 11:48955580-48955602 AGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1082233643 11:49798198-49798220 GGTGGCGGGCAGCCCACACCTGG - Intergenic
1082233699 11:49798328-49798350 GGTGGGGGGTAGCCCCTGCCCGG - Intergenic
1082233738 11:49798419-49798441 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1082706230 11:56497339-56497361 GGTGGGGGTCAGCCCCTGCCCGG + Intergenic
1082706251 11:56497385-56497407 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1082706273 11:56497431-56497453 GGTGGGGGGCAGCCCCTACCCGG + Intergenic
1082870974 11:57943807-57943829 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1083042301 11:59699872-59699894 GGTGGGAGTCAGCCCCCGCCAGG + Intergenic
1083079179 11:60073183-60073205 AGGTGGGGGCAGCCCCCGCCCGG - Intergenic
1083091116 11:60201104-60201126 TGGGGGGGTCAGACCCCGCCCGG - Intergenic
1083091190 11:60201280-60201302 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1083118933 11:60491781-60491803 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1083120834 11:60510465-60510487 GGTGGGGGGCAGCCCCTGCCCGG + Intergenic
1083120853 11:60510506-60510528 GGTGGGGGGCAACCCCCGCCCGG + Intergenic
1083120870 11:60510548-60510570 GGTGGGGGCCAGCCCCCGTCCGG + Intergenic
1083173502 11:60936120-60936142 GGCAGGGGGCAGCCCCAGCCAGG - Exonic
1083208245 11:61166424-61166446 AGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1083718786 11:64593800-64593822 AGTGGGGCACAGCACCCACCAGG - Exonic
1083826734 11:65208153-65208175 TGTGAGGGGCAGCCCTCTCCTGG + Intronic
1083865483 11:65451221-65451243 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1083917971 11:65762808-65762830 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1084269472 11:68021363-68021385 AGCGGGCAGCAGCCCTCGCCTGG - Intronic
1084338322 11:68475530-68475552 GTGGGGGGCCAGCCCCCGCCCGG - Intronic
1084338345 11:68475577-68475599 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1084338368 11:68475623-68475645 GGTGGGGGGCAGCCCCCACCCGG - Intronic
1084338391 11:68475669-68475691 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1084607777 11:70182461-70182483 AGTGAGGGGGACCCCCAGCCTGG - Intronic
1084774732 11:71367961-71367983 ATGGGGGCGCAGCCCCTGCCAGG + Intergenic
1084839266 11:71831588-71831610 CCCCGGGGGCAGCCCCCGCCCGG + Intergenic
1084839291 11:71831634-71831656 GGTGGGGGGCCGCCTCCGCCCGG + Intergenic
1085073780 11:73572158-73572180 GGTGGGGGTCAGCCCCTGCCCGG + Intronic
1085073823 11:73572252-73572274 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1085097833 11:73775247-73775269 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1085097854 11:73775293-73775315 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1085097875 11:73775339-73775361 GGTGGGGGGCAGCCCCTGCCCGG + Intergenic
1085159661 11:74328509-74328531 AGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1085288356 11:75378979-75379001 GGTGGGGGGCAGTCCCCGCCTGG - Intergenic
1085360083 11:75877949-75877971 GGTGGGGGTCAGCCCCCACCAGG - Intronic
1085443322 11:76582521-76582543 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1085480903 11:76821676-76821698 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1085791381 11:79500158-79500180 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
1086446937 11:86879449-86879471 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1086697295 11:89860926-89860948 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1086708864 11:89983561-89983583 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1087214779 11:95482684-95482706 GATGGGGGTCAGCCCCCGCCAGG + Intergenic
1087761754 11:102110450-102110472 AGTCGGGCGCAGCCGCCGCCAGG + Exonic
1087977213 11:104564996-104565018 AGCAGGGGGCAGCGCCCGCCGGG + Intergenic
1088116205 11:106317299-106317321 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1088116246 11:106317392-106317414 GGTGGGGGTCAGCCCCCACCCGG - Intergenic
1088658863 11:112026932-112026954 TGGGGGGGTCAGCCCCCGCCTGG - Intronic
1088658907 11:112027029-112027051 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1089148520 11:116347334-116347356 GTGGGGGAGCAGCCCCCGCCCGG + Intergenic
1089148567 11:116347428-116347450 GGTGGGGGGCAGCCTCCGCCCGG + Intergenic
1089420969 11:118331577-118331599 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
1089421021 11:118331703-118331725 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
1089510109 11:118991611-118991633 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
1089520392 11:119059231-119059253 GGTGGGGGGGCGCCTCCGCCCGG - Intergenic
1090323009 11:125863264-125863286 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1091628753 12:2142070-2142092 GGTGGGGGACAGCCACCACCTGG + Intronic
1091824822 12:3504481-3504503 ACTGGGAGGCACCCCCCACCAGG - Intronic
1091943251 12:4509610-4509632 ACTGGGAGGCACCCCCCGGCAGG + Intronic
1092185434 12:6475427-6475449 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1092331451 12:7590274-7590296 GGTGGGGTTCAGCCCCCGCCAGG - Intergenic
1092501438 12:9051314-9051336 AGAGAGGAGCAGCCCCCTCCAGG + Intergenic
1092843850 12:12566235-12566257 GGTGGGGCTCAGCCCCCGCCAGG + Intergenic
1093038534 12:14354857-14354879 TGGGGGGGGCAACCCCTGCCCGG + Intergenic
1093927841 12:24926332-24926354 AGTTGGGGGCAGCCCCCGCCTGG + Intronic
1094041052 12:26122362-26122384 ACGGGGCGGCAGCCGCCGCCGGG + Exonic
1094209461 12:27874238-27874260 GGTGGGGGTTAGCCCCCGCCAGG + Intergenic
1094514069 12:31117846-31117868 AGTCGGAGGCACCCCCCGCGAGG + Intergenic
1094514725 12:31119955-31119977 AGGGGGAGGTAACCCCCGCCAGG + Intergenic
1094608694 12:31972309-31972331 AGTGGGGGGCAGTCTCGGCTGGG + Intronic
1094670322 12:32563130-32563152 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1094716933 12:33022834-33022856 GGTGGGGGCCAGCCCCTGCCCGG - Intergenic
1095113824 12:38330356-38330378 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1095113868 12:38330449-38330471 GGGGGGGGTCAGCCCCTGCCCGG - Intergenic
1095281059 12:40353076-40353098 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1095452771 12:42350061-42350083 AGGTGGGGGGCGCCCCCGCCCGG - Intronic
1095452790 12:42350101-42350123 AGGTGGGGGGCGCCCCCGCCCGG - Intronic
1095571132 12:43685311-43685333 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1095591361 12:43907208-43907230 ACTGGGAGGCACCCCCCGGCAGG + Intronic
1095672370 12:44876246-44876268 GGTGCGGGGCCGCCCCAGCCCGG - Intronic
1096041421 12:48520560-48520582 GTGGGGGGGCAGCCCCCACCTGG - Intronic
1096708366 12:53437667-53437689 GGTGGGGGGCGGCCCCCGCCCGG + Intergenic
1096856634 12:54488374-54488396 GGTGGGGGTCAACCCCCGCCAGG - Intergenic
1096999353 12:55863204-55863226 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1097110028 12:56651705-56651727 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1097126986 12:56783580-56783602 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1097127083 12:56783806-56783828 GGTGGGGGTCAGCCCCCGCCCGG - Intronic
1097128088 12:56789721-56789743 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1097149150 12:56963753-56963775 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1097228573 12:57495163-57495185 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1097228591 12:57495205-57495227 GGTGGGGGGCAGCGCCCGCCTGG - Intronic
1097230495 12:57507743-57507765 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1097230516 12:57507790-57507812 GGTGGGGGTCAGCCTCCGCCCGG - Intronic
1097439795 12:59595953-59595975 GGTGGGGGGGAGCCGCCTCCCGG - Intergenic
1098018992 12:66134830-66134852 TGGGGGGGTCAGCCCCTGCCCGG + Intronic
1098130124 12:67341324-67341346 GATGGGGGGCAGCCCCCGCCTGG - Intergenic
1098130145 12:67341370-67341392 GGTGGGGGGCAGCCCCCACCCGG - Intergenic
1098333068 12:69374995-69375017 AGGTGGGGGCAGCCCCCGCCCGG - Intronic
1098333087 12:69375036-69375058 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1098370928 12:69759734-69759756 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1098379423 12:69853202-69853224 GGTAGGGGGCAGCCCCTGCCCGG - Intronic
1098379444 12:69853248-69853270 GATGGGGGGCAGCCCCTGCCCGG - Intronic
1098773867 12:74588145-74588167 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1098883769 12:75941909-75941931 GGTGGGGGTCAGCCCCCGCAAGG + Intergenic
1099255420 12:80307909-80307931 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1100048248 12:90411277-90411299 GGTGGGGTTCAGCCCCCGCCCGG + Intergenic
1100048268 12:90411315-90411337 GGTAGGGGGCAGGCCCCGCCCGG + Intergenic
1100507387 12:95235275-95235297 GGTGGGGGTCAGCCCCCGCCCGG - Intronic
1100995115 12:100294561-100294583 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1101639930 12:106580681-106580703 GGTGGGCGGCTGCCACCGCCCGG - Intronic
1101885288 12:108656381-108656403 GTGGGGGGGCAGCCCCCGCCCGG + Intronic
1102089290 12:110172940-110172962 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1102268320 12:111507490-111507512 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
1102323355 12:111957490-111957512 GGTGGGGGGCAGCGCCCCCCTGG + Intronic
1102323393 12:111957574-111957596 GGTGGGGGCCAGCCCCCGCCCGG + Intronic
1103238887 12:119397758-119397780 AGCAGGGGGCAGCGCCCGTCAGG + Intronic
1103414000 12:120732253-120732275 GGTGGGGGTCAGCCCCCGCCCGG - Intronic
1103414022 12:120732299-120732321 GGTTGGGGGCAGCCCCCGCCCGG - Intronic
1103699685 12:122842632-122842654 CGTGTGGGGCAGCCGCTGCCTGG + Intronic
1103940640 12:124499586-124499608 CTTGGGGGTGAGCCCCCGCCAGG + Intronic
1104029397 12:125053589-125053611 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1104712829 12:130997293-130997315 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1104858780 12:131914106-131914128 AGTGGGGGGCCACCCTGGCCGGG - Intronic
1104861431 12:131926353-131926375 GGTGGGGGTCAGCCCCCACCAGG - Intergenic
1104970663 12:132529270-132529292 AGTGGGGGGCCGTCCCCACCAGG - Intronic
1105247563 13:18666742-18666764 AGTGGAGTGCACCCCCAGCCGGG + Intergenic
1105692796 13:22859025-22859047 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1105692817 13:22859071-22859093 GGTAGGGGTCAGCCCCCGCCAGG - Intergenic
1105980532 13:25513047-25513069 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1106114599 13:26806332-26806354 GGTGGGGGTCAGCCCCCGCCTGG - Intergenic
1106114621 13:26806378-26806400 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1106746846 13:32716567-32716589 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1106747581 13:32721258-32721280 AGGTGGGGGGCGCCCCCGCCCGG - Intronic
1106747617 13:32721338-32721360 AGGTGGGGGGAGCCCTCGCCCGG - Intronic
1106799527 13:33242206-33242228 GGTGGGGGGCAGCCCCCACCCGG + Intronic
1107251077 13:38363899-38363921 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1107251097 13:38363941-38363963 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1107493342 13:40901097-40901119 TGGGGGGGTCACCCCCCGCCCGG + Intergenic
1107588873 13:41881893-41881915 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1107940634 13:45378006-45378028 GGGGGGAGGCACCCCCCGCCAGG - Intergenic
1107941223 13:45380549-45380571 GGGGGGAGGCACCCCCCGCCAGG - Intergenic
1108024430 13:46163010-46163032 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1108370366 13:49762105-49762127 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1108370389 13:49762151-49762173 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1108370408 13:49762197-49762219 GGTGGAGGGCAGCCCCCGCCCGG + Intronic
1108501989 13:51078016-51078038 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1108502108 13:51078287-51078309 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1108608569 13:52063899-52063921 GGTGGGGGTCAGCCCCTGCCAGG + Intronic
1108610553 13:52080166-52080188 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1108991093 13:56659154-56659176 AGCAGGGGGCAGCACCCGTCGGG + Intergenic
1109546313 13:63840789-63840811 GGGGGGAGGCACCCCCCGCCAGG + Intergenic
1109723936 13:66315112-66315134 AGTTGAGGGCAGCCCCCCACTGG + Intronic
1110922115 13:81102083-81102105 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1111230613 13:85340793-85340815 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1111388625 13:87561841-87561863 GGTGGGGGGCAGCCCCTGCCCGG + Intergenic
1112077204 13:95928244-95928266 GGTAGGGGGCAGCCCCTGCCCGG - Intronic
1112077222 13:95928286-95928308 GGTGGGGGGCAGCCCCTGCCCGG - Intronic
1112077239 13:95928328-95928350 GGTGGGGGGCAGCCCTCGCCAGG - Intronic
1112420454 13:99242720-99242742 GGTGGGGGTCAGCCCCGGCCAGG - Intronic
1113194026 13:107782919-107782941 GGTGGGGGTCACCCCCCGCCCGG + Intronic
1113329164 13:109311756-109311778 GGTGGGGGGCAGCCCTCGCCCGG + Intergenic
1113329184 13:109311802-109311824 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1113343865 13:109454331-109454353 AGTGGGAGGCAGCCTCTGTCTGG - Intergenic
1114137307 14:19866651-19866673 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1114427969 14:22637902-22637924 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1114507960 14:23232594-23232616 TTGGGGGGTCAGCCCCCGCCCGG + Intronic
1114508003 14:23232688-23232710 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1114508027 14:23232736-23232758 TGGGGGGGTCAGCCCCCACCCGG + Intronic
1114594271 14:23898336-23898358 AGGTGGGGGGCGCCCCCGCCCGG - Intergenic
1115259429 14:31437300-31437322 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1115271675 14:31560142-31560164 GGTGGGGGGCAGACCCCGCCCGG - Intronic
1115271696 14:31560188-31560210 CGTGGGGGGCAGCCCCCATCCGG - Intronic
1115284306 14:31700866-31700888 AGCAGGGGGCAGCACCCGTCGGG - Intronic
1115493900 14:33984407-33984429 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1115493921 14:33984453-33984475 GGTGGGGGGCAGCCCCCACCCGG - Intronic
1115547504 14:34476328-34476350 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
1115622305 14:35152592-35152614 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1115688918 14:35824717-35824739 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1115847648 14:37555680-37555702 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1116005209 14:39285368-39285390 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1116005232 14:39285414-39285436 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1116005255 14:39285462-39285484 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1116005278 14:39285509-39285531 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1116005300 14:39285556-39285578 TCGGGGGGTCAGCCCCCGCCCGG - Intronic
1116005323 14:39285604-39285626 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1116191636 14:41673787-41673809 GGGGGGGGTCACCCCCCGCCCGG - Intronic
1116409144 14:44601566-44601588 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1116729033 14:48598662-48598684 GGTGGGGGGGCGCCCCCACCCGG + Intergenic
1116841087 14:49821213-49821235 TGGGGGGGTCAGCCCCCGCCAGG + Intronic
1117411674 14:55456362-55456384 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1117602699 14:57391044-57391066 AGGCGAGGGCGGCCCCCGCCGGG - Exonic
1118184190 14:63522810-63522832 GGTGGGGGTCACCCACCGCCAGG + Intronic
1118209244 14:63751083-63751105 GGTGGGGGTCAGTCCCCGCCCGG - Intergenic
1118209266 14:63751129-63751151 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1118209310 14:63751223-63751245 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1118253219 14:64183006-64183028 AGGCGGGGGCAGCCCCCGCCTGG - Intronic
1118423586 14:65633893-65633915 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
1118584763 14:67341561-67341583 TGGGGGGGTCAGCCCCCGCCAGG + Intronic
1118955598 14:70477715-70477737 GTGGGGGGGCAGCCCCCGCCCGG + Intergenic
1118955619 14:70477760-70477782 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1118955663 14:70477852-70477874 GGTGGGGGTCAGCCCCCGCCCGG + Intergenic
1119051805 14:71377187-71377209 GGTGGGGGGGCGCCCCCACCCGG - Intronic
1119594948 14:75925175-75925197 TGGGGGGGTCAGCCCCCGCCAGG - Intronic
1119594971 14:75925223-75925245 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1119698601 14:76734645-76734667 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1119721996 14:76898074-76898096 TGTGGGGGTCAGCCCCCGCCCGG - Intergenic
1119835776 14:77747749-77747771 GGTGGGGGCCAGCCCCTGCCTGG + Intronic
1119868502 14:77993692-77993714 GGTGGGGGTCAGCCCCCACCAGG - Intergenic
1120170536 14:81244504-81244526 GGTGGGGGGCAGCCCCTGCCCGG - Intergenic
1120406522 14:84099495-84099517 GGTGGGGGCCAGCCCCCGCCCGG - Intergenic
1120406545 14:84099541-84099563 GGTGGGGGCCAGCCCCCGCCCGG - Intergenic
1120406567 14:84099587-84099609 GAGGGGGGGCAGCCCCCACCCGG - Intergenic
1120505775 14:85352699-85352721 GGTGGGGGTCAGCCCCCACCCGG - Intergenic
1121142892 14:91557552-91557574 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1122462446 14:101906835-101906857 AGTGGGGCTCAGCCCCGGCGGGG + Intronic
1122497929 14:102172700-102172722 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1122626760 14:103089032-103089054 AGGAGGGGGCAGCCGGCGCCAGG + Intergenic
1122772623 14:104104114-104104136 TGGGGGGAGCAGCCCCCTCCAGG + Intronic
1122922025 14:104884255-104884277 CGTGGGGCGCCGCTCCCGCCTGG + Exonic
1122961969 14:105098045-105098067 AATGGTGGGCACCTCCCGCCAGG + Intergenic
1202848113 14_GL000009v2_random:200136-200158 GGTGGGGGTCAGCCCACGCCCGG + Intergenic
1202917641 14_GL000194v1_random:190852-190874 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1123429644 15:20203908-20203930 GGTAGGGGGCAGCCCCCACCCGG - Intergenic
1123429667 15:20203954-20203976 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1123705950 15:22951365-22951387 AGTGCAGGGCAGCCCCGGCCGGG + Intronic
1124335031 15:28849731-28849753 GGTGGGGGTCAACCCCCGCCCGG - Intergenic
1124607910 15:31184787-31184809 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1125459381 15:39893770-39893792 TGGGGGGGTCAGCCCCCGCCTGG - Intronic
1125459533 15:39894123-39894145 TGGGGGGGTCAGCCCCCGCCTGG - Intronic
1125740740 15:41962672-41962694 GGCGGGGGGCAGCCCCCACCCGG + Intronic
1125817802 15:42601481-42601503 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1125817823 15:42601523-42601545 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1125817865 15:42601608-42601630 AGTGGGGGGCAGCCCCCACCCGG - Intronic
1125861606 15:43005287-43005309 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1125861626 15:43005328-43005350 GGTGGGGGGCAGCCCCCGCCTGG + Intronic
1125861646 15:43005374-43005396 GGTGAGGGGCAGCCCCCGCCCGG + Intronic
1125861666 15:43005420-43005442 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1125862865 15:43014832-43014854 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
1125862887 15:43014879-43014901 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1125862907 15:43014925-43014947 GGTGTGGGTCAGCCCCCGCCCGG + Intronic
1125862927 15:43014972-43014994 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1125862947 15:43015019-43015041 GTTGGGGGTCAGCCCCCGCCCGG + Intronic
1125930040 15:43593889-43593911 AGGGGTGGGCAGCACCCGCCAGG - Intronic
1125943208 15:43693721-43693743 AGGGGTGGGCAGCACCCGCCAGG - Exonic
1126517162 15:49550372-49550394 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1126571603 15:50158388-50158410 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
1126571647 15:50158481-50158503 GGTGGGGGGGCGCCTCCGCCCGG + Intronic
1126573213 15:50172965-50172987 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1126573234 15:50173007-50173029 GGTGGGGGGCAGCCCCCATCCGG + Intronic
1126573246 15:50173031-50173053 AGGTGGGGGCAGCCTCCGCCCGG + Intronic
1126751897 15:51885905-51885927 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1126751918 15:51885951-51885973 GGTAGGGGGCAGCCCCTGCCCGG - Intronic
1126799444 15:52286220-52286242 GTGGGGGGTCAGCCCCCGCCAGG + Intronic
1127282350 15:57503162-57503184 AGAGCCTGGCAGCCCCCGCCTGG - Intronic
1127584734 15:60367688-60367710 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1127644686 15:60947015-60947037 GTGGGGGGCCAGCCCCCGCCCGG + Intronic
1127644733 15:60947110-60947132 TGGGGGGGTCAGCCCCCACCCGG + Intronic
1128071316 15:64799134-64799156 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1128489770 15:68134706-68134728 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1128489963 15:68135133-68135155 TGGGGGGGTCAGCCCCCGCCAGG - Intronic
1128490012 15:68135230-68135252 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1128490198 15:68135658-68135680 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1128597443 15:68964644-68964666 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1128843688 15:70871569-70871591 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1128970516 15:72101640-72101662 TGGGGGGGTCAGGCCCCGCCCGG + Intronic
1128970614 15:72101865-72101887 TGGGGGGGTCAGCCCCCGACCGG + Intronic
1129008767 15:72396721-72396743 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1129313798 15:74729098-74729120 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1129466745 15:75728360-75728382 AGTGGGAGGCAGCTCCCAGCTGG + Intergenic
1129538640 15:76334011-76334033 AGGAGGGGGCAGCCCCAGGCTGG - Intergenic
1129660078 15:77548538-77548560 AGTGGGGGGCAGGAGGCGCCGGG - Intergenic
1130071158 15:80647699-80647721 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1130071176 15:80647741-80647763 GGTGGGTGGCAGACTCCGCCCGG + Intergenic
1130428290 15:83822164-83822186 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1130522453 15:84673130-84673152 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1130942726 15:88524338-88524360 GGTGGGGGGCAGCCCCTGCCTGG + Intronic
1130949400 15:88573596-88573618 AGTGGGTGGCAGCACCTGCATGG - Intergenic
1130988471 15:88860314-88860336 TGGGGGTTGCAGCCCCCGCCAGG + Exonic
1131043867 15:89297006-89297028 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1132105015 15:99057120-99057142 AGTTGGGGGCAACCCCATCCGGG - Intergenic
1132205508 15:99983652-99983674 AGTGGGGGGCAGCCCTGCCTGGG - Intronic
1132348442 15:101122409-101122431 AGTGGCGGGCAGACCCTGCCCGG + Intergenic
1132670698 16:1101146-1101168 AGTGAGGGGAAGCCCCGCCCTGG + Intergenic
1132702616 16:1228555-1228577 TGTGGGGGGCAGTCGCCACCTGG + Exonic
1132705711 16:1242313-1242335 TGTGGGGGGCAGTCGCCACCTGG - Exonic
1132709060 16:1258569-1258591 TGTGGGGGGCAGTCACCACCTGG - Exonic
1132715787 16:1289239-1289261 TGGGCGGGGCAGCCCCCTCCTGG + Intergenic
1132776771 16:1599323-1599345 GGGGGGGGTCAGCCCCCGCCAGG + Intronic
1132830049 16:1923580-1923602 CGGGGTGGGCAGCCCCAGCCTGG + Intergenic
1132892504 16:2211108-2211130 ACTGGAGGGCAGCCCAGGCCCGG + Exonic
1133918262 16:10128577-10128599 AGAGGTGGGCAGCACCCTCCAGG + Intronic
1134750114 16:16619010-16619032 AGGTGGGGGCAGCCCCCGCCCGG - Intergenic
1134750133 16:16619055-16619077 GGTGGGGGGCAGCCCCCGCTCGG - Intergenic
1134995342 16:18734583-18734605 GGTGGGGGGCAGCCCCCGCTCGG + Intergenic
1134995361 16:18734628-18734650 AGGTGGGGGCAGCCCCCACCCGG + Intergenic
1135694285 16:24574102-24574124 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1136020036 16:27434343-27434365 AGGTCGGGGCAGCCCCAGCCTGG - Exonic
1136155186 16:28377478-28377500 GGTGGGGGTAAGCCCCCTCCAGG + Intergenic
1136207923 16:28737861-28737883 GGTGGGGGTAAGCCCCCTCCAGG - Intergenic
1136426376 16:30170326-30170348 TTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1136573048 16:31108359-31108381 CGTGGGCGGCAGCGCCCGCTGGG - Intronic
1136918930 16:34245767-34245789 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1136918988 16:34245908-34245930 ATGGGGGGTCAGCCCCTGCCCGG - Intergenic
1137240770 16:46653323-46653345 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1137240792 16:46653370-46653392 GGTAGGGGTCAGCCCCCACCCGG - Intergenic
1137439031 16:48483092-48483114 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1137439049 16:48483134-48483156 GGTGGGGGGCAGCCCCTGCCTGG - Intergenic
1137493512 16:48951926-48951948 GGGGGGGGTCAGGCCCCGCCAGG + Intergenic
1138043437 16:53698269-53698291 GTGGGGGGTCAGCCCCCGCCAGG + Intronic
1138206192 16:55126971-55126993 AGTGGGGGGCAGCCCTTTACCGG - Intergenic
1138642350 16:58396506-58396528 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1139394789 16:66631164-66631186 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
1139394858 16:66631307-66631329 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1139475581 16:67201003-67201025 AGGGTGGGGCAGCGCCCACCGGG - Intronic
1139623190 16:68163531-68163553 GGTGGGGGTCAGCCCCCACCAGG - Intronic
1139639240 16:68278972-68278994 GGTGGGGGGCAGCCCCTGCCCGG - Intronic
1139642459 16:68302359-68302381 GGTGGGTGGCAGCCCCAGACCGG - Exonic
1139864284 16:70051329-70051351 AGGGGGGGTCAGCCCCCTGCCGG + Intergenic
1140063312 16:71589626-71589648 GGTGGGGGTCAGCCCCCACCAGG + Intergenic
1140602979 16:76500220-76500242 AGGTGGGGGCAGCCCCTGCCAGG - Intronic
1142011808 16:87719047-87719069 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1142058327 16:88014382-88014404 GGTGGGTGGCAGCACCCCCCAGG + Intronic
1142156575 16:88535105-88535127 CGCAGGGGGCAGCGCCCGCCTGG + Exonic
1142223565 16:88866632-88866654 AGTGGAGGGGAGGCCTCGCCTGG - Intronic
1142291665 16:89196064-89196086 CCTGCGGGGCCGCCCCCGCCAGG - Exonic
1142472071 17:170218-170240 GGTGGGCTGGAGCCCCCGCCAGG + Intronic
1142906907 17:3049475-3049497 AGTGGGAGGCAGCCCCAGCCAGG + Intergenic
1142939855 17:3371913-3371935 GGTGGGGGTCAGCCCCCGCCCGG - Intergenic
1142963202 17:3564297-3564319 GGTGGGGGTCACCCACCGCCAGG - Intergenic
1143059197 17:4185834-4185856 AGAGCCGCGCAGCCCCCGCCCGG + Intronic
1143328978 17:6120260-6120282 AGTCGGGGGCTGGCCCTGCCAGG - Intronic
1143626019 17:8110474-8110496 AGTGGGTGGGGGCCTCCGCCAGG + Exonic
1143667736 17:8373994-8374016 GGTGGGGGGCAGCCCCTGCCTGG + Intronic
1143667757 17:8374040-8374062 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1143884820 17:10057580-10057602 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1144536399 17:16095392-16095414 GTGGGGGGTCAGCCCCCGCCAGG + Intronic
1144559742 17:16312075-16312097 GTGGGGGGGCAGCCCCCACCCGG - Intronic
1144559767 17:16312122-16312144 GGCTGCGGGCAGCCCCCGCCCGG - Intronic
1144829479 17:18123284-18123306 AGCGCGGGGCATCCGCCGCCGGG - Intronic
1144866413 17:18338400-18338422 GGTGGGGGGCAGCCCCCGCCTGG + Intronic
1145022303 17:19441686-19441708 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1145087081 17:19951135-19951157 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1145087103 17:19951182-19951204 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1145087126 17:19951229-19951251 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1145920211 17:28604344-28604366 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1146157675 17:30537035-30537057 TGGGGGGGGCAGCCCCCGCCCGG - Intergenic
1146170015 17:30625532-30625554 ACTGGGTGGCACCCCCTGCCAGG + Intergenic
1146731234 17:35195093-35195115 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1146731253 17:35195140-35195162 GGTGGGGGGCAGCCCCCGCCGGG - Intergenic
1147278436 17:39337772-39337794 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1147278456 17:39337819-39337841 GTGGGGGGTCAGCCCCCGCCAGG + Intronic
1147278477 17:39337865-39337887 GGAGGGGGTCAGGCCCCGCCCGG + Intronic
1147709084 17:42449361-42449383 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1147809656 17:43159355-43159377 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
1147809677 17:43159401-43159423 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1147974196 17:44238239-44238261 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1148241751 17:46003752-46003774 AGTGGGGGGCAGAGCCAGGCTGG + Intronic
1148299523 17:46534814-46534836 GGTGGGGGCCAGCCCCCGCCTGG - Intronic
1148404304 17:47397917-47397939 GGTGGGGGTCAGCCCCCGCTAGG + Intronic
1148404393 17:47398111-47398133 TGGGGGGGTCAGCCCCCCCCTGG + Intronic
1148406493 17:47420813-47420835 GGTGGGGGTCAGCCCCCACCAGG + Intronic
1148422109 17:47556698-47556720 GGCGGGGGGCAGCCCCCACCCGG - Intronic
1148632862 17:49125700-49125722 GGTGGGGGTCGGCCCCCGCCGGG + Intergenic
1148852205 17:50560851-50560873 AGTGGGGGGCAGTCCCGGGCGGG - Intergenic
1149556993 17:57580430-57580452 TGTGGGGGGCAGGCCTCACCCGG - Intronic
1149593004 17:57846203-57846225 GGTGGGGGGCAGCCCCCGCCTGG + Intronic
1149793695 17:59500477-59500499 GGGGGGGGTCAGCCCCCGCCAGG + Intergenic
1149865673 17:60149865-60149887 AGGGGAGGGCAGGCCCCGCCAGG + Intergenic
1149950180 17:60977055-60977077 GGTGCAGGGCAGCCCCCGCCCGG - Intronic
1149950198 17:60977097-60977119 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1149950217 17:60977139-60977161 CGTGGGGGGCAGCCCCCGCCTGG - Intronic
1150061544 17:62072997-62073019 GGTGGGGGCCAGCCCCCGCCCGG + Intergenic
1150402991 17:64874474-64874496 GGTGGGGGCCAGCCCCCGCCCGG + Intronic
1150780265 17:68116233-68116255 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1150790337 17:68197235-68197257 AGGGTGGGGCCGCCCCTGCCCGG - Intergenic
1150894582 17:69196138-69196160 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1150894603 17:69196184-69196206 GGTGGGGGGCAGCCCCTGCCCGG - Intronic
1151705273 17:75764044-75764066 GCTGGTGGGCAGCCCCCGCAAGG - Exonic
1152071693 17:78137370-78137392 AGGGAGGGACAGGCCCCGCCGGG - Intronic
1152129163 17:78465759-78465781 GGGGGCGGTCAGCCCCCGCCAGG + Intronic
1152336520 17:79702341-79702363 AGTGGTGGCCAGCCTGCGCCTGG - Intergenic
1152873887 17:82774665-82774687 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1153243211 18:3049793-3049815 GGTGGGGGGCATCCCCTGCCCGG + Intergenic
1153541891 18:6164414-6164436 ACTGGGAGGCACCCCCCGCTAGG + Intronic
1154115255 18:11608753-11608775 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1154158214 18:11959994-11960016 GGTCGGGGTCAGCCCCCGCCAGG + Intergenic
1154265186 18:12874154-12874176 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1154265297 18:12874407-12874429 TGGGGGGATCAGCCCCCGCCCGG + Intronic
1154289901 18:13098262-13098284 GTGGGGGGTCAGCCCCCGCCTGG - Intronic
1154289922 18:13098309-13098331 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1154441277 18:14392379-14392401 AGTGGAGTGCACCCCCAGCCAGG - Intergenic
1154990235 18:21592640-21592662 GGTGGGGGTCAGCCCGCGCCAGG - Intronic
1155956496 18:31960436-31960458 GGTGGGGGTCAGCCCCCGCCCGG + Intergenic
1155990437 18:32274033-32274055 GGTGAGGGGCAGCCCACGGCAGG + Intronic
1156066403 18:33147981-33148003 GGTGGGGGGCAGCCCCTGCCCGG - Intronic
1156242990 18:35271696-35271718 AGCAGGGGGCGGCACCCGCCGGG + Intronic
1156326289 18:36077700-36077722 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1157455911 18:47828226-47828248 GGTGGGGGGCAGCCCCTGCTCGG + Exonic
1157455929 18:47828268-47828290 GGTGGGGGGCAACCCCCGCCCGG + Exonic
1157629246 18:49080149-49080171 TGGGGGGGTCAGCCCCCCCCCGG - Intronic
1157629424 18:49080579-49080601 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1157705223 18:49800081-49800103 GGTGGGGGTCAGCCCCCACCAGG + Intronic
1157705245 18:49800127-49800149 GGTGGGGGTCAGCCCCCGGCCGG + Intronic
1157799723 18:50609376-50609398 GGCGGGGGGCAGCCCCCGCCCGG - Intronic
1157857669 18:51117171-51117193 GGTGGGGGGCGAACCCCGCCCGG - Intergenic
1157857690 18:51117213-51117235 GGTGGGGGGCAGCCCCCACCCGG - Intergenic
1157978520 18:52353490-52353512 AGTATGGGGTAGCCCCCGTCAGG - Intronic
1158271402 18:55720781-55720803 ACTGGGAGGCACCCCCCACCAGG - Intergenic
1158646930 18:59255800-59255822 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1158646950 18:59255842-59255864 GGTGGGGGGCAGCCCCCGCCTGG + Intergenic
1158732034 18:60034960-60034982 ACTGGGAGGCACCCCCCACCAGG - Intergenic
1159614861 18:70569633-70569655 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1160465413 18:79072689-79072711 GGTGGGGGGGCGCCCCCACCCGG - Intronic
1160787742 19:909121-909143 AGAGGGGGGCAGCCCAAGCTGGG + Intronic
1160792644 19:929639-929661 CGTCGGGGGCAGCCCGGGCCCGG - Exonic
1160930288 19:1567097-1567119 GGTGTGGGGCGCCCCCCGCCCGG + Intronic
1161015420 19:1980641-1980663 AGGGGAGGGCAGGCCCGGCCTGG + Exonic
1161209929 19:3061287-3061309 AGGGGGGTCCAGCCCACGCCTGG - Intronic
1161342945 19:3752789-3752811 GGTGCTGGGCAGCCCCCACCTGG - Intronic
1161386763 19:3998781-3998803 GGCCGGGGGCAGCCCCCGCCCGG + Intergenic
1161386785 19:3998827-3998849 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1161531672 19:4793375-4793397 AGTGGAGTGCACCCCCAGCCAGG + Exonic
1161606059 19:5215600-5215622 AGGGTGGAGCAGACCCCGCCGGG + Intronic
1161659397 19:5536721-5536743 AGGGGCGGGCAGCGCCGGCCGGG - Intergenic
1162164008 19:8739839-8739861 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1162255139 19:9483486-9483508 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1162255164 19:9483533-9483555 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1162255189 19:9483580-9483602 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1162255210 19:9483626-9483648 GGTGGGGGCCAGCCCCCCGCCGG + Intronic
1162538168 19:11276702-11276724 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
1162602027 19:11676798-11676820 GGTGGGGGGGCGCCTCCGCCTGG - Intergenic
1162602047 19:11676840-11676862 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
1162683265 19:12362542-12362564 GGTGGGGGACAGCTCCCGCCCGG + Intronic
1162683286 19:12362588-12362610 GGTGGGGGGCAGCCCCCGCCTGG + Intronic
1162695088 19:12467930-12467952 GGTGGGGGTCAGCCCCCGCACGG + Intronic
1162695108 19:12467976-12467998 GGTGGGGGTCAGCCCCCGCACGG + Intronic
1162695129 19:12468023-12468045 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1162695151 19:12468070-12468092 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1163005994 19:14397017-14397039 AGTGGAGGGCAGGCCCAGGCTGG + Intronic
1163061752 19:14766419-14766441 AGTGGAGGGCAGGCCCAGGCTGG - Intronic
1163262912 19:16201969-16201991 AGTGGGGGAGAGACCCCGTCTGG + Intronic
1163613414 19:18312303-18312325 AGGCTGGGGCAGCCCCCTCCAGG - Intronic
1163687308 19:18719175-18719197 AGTTGGAGGCTGCGCCCGCCAGG - Intronic
1163865566 19:19770274-19770296 AGTGGGGGGCAGCTCCCGTCCGG + Intergenic
1163896457 19:20064458-20064480 GGTGGGGGTCAGCCCCCACCAGG - Intergenic
1163904319 19:20137985-20138007 GGTGGGGGTCAGCCCCCGCCCGG + Intergenic
1163909399 19:20175995-20176017 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1163996111 19:21048800-21048822 GGTTGGGGCCAGCACCCGCCCGG - Intronic
1163996130 19:21048846-21048868 GGTGGGGGGCAGCCCCTGCCCGG - Intronic
1164012107 19:21212574-21212596 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1164040187 19:21486943-21486965 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1164043153 19:21511198-21511220 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1164043177 19:21511246-21511268 GGTGGGGGTCAGCCCCCCACCGG - Intronic
1164046914 19:21551274-21551296 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1164046961 19:21551368-21551390 GTGGGGGGCCAGCCCCCGCCCGG - Intronic
1164046984 19:21551415-21551437 GGTGGGGGTCAGCCCCCGCCCGG - Intronic
1164054049 19:21607135-21607157 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1164105286 19:22105233-22105255 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1164105309 19:22105279-22105301 GGTGGGGGGCAGCCCCTGCCCGG + Intergenic
1164105329 19:22105325-22105347 GGTGGGGGCCAGCCCCCGCTCGG + Intergenic
1164105371 19:22105416-22105438 GGTGGGGGGCAGCCCCTGCCCGG + Intergenic
1164105846 19:22107310-22107332 TGGGGGGGTCAGACCCCGCCCGG - Intergenic
1164168085 19:22700456-22700478 GGTGGGGGCCAGTCCCCACCCGG - Intergenic
1164168105 19:22700502-22700524 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
1164168486 19:22702946-22702968 AGGTGGGGGCAGCCCCCGCCCGG - Intergenic
1164168504 19:22702987-22703009 GGTGGGGGGCAGCCCCCGTCCGG - Intergenic
1164186166 19:22871566-22871588 TGGGGGGGTCAGCCCCTGCCAGG - Intergenic
1164192113 19:22926196-22926218 TGGGGGGGTCAGCCCCCCCCCGG + Intergenic
1164192393 19:22926825-22926847 TGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164192622 19:22927358-22927380 TGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164192803 19:22927763-22927785 TGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164192900 19:22927963-22927985 GGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164217239 19:23160940-23160962 GGTGGGGGGCAGTCCCCGCCCGG - Intergenic
1164231159 19:23289979-23290001 AGGTGGGGGCAGCCCCCGCCTGG - Intergenic
1164238919 19:23366185-23366207 TGGGGGGGTCAGCCCCCGCCGGG - Intronic
1164239244 19:23369339-23369361 GGTGGGGGGCAGCCCCCACCCGG + Intronic
1164244707 19:23419476-23419498 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1164244729 19:23419522-23419544 GGTGGGGGCCAGCCCCCGCCCGG + Intergenic
1164244752 19:23419568-23419590 GGTGGGGGCCAGCCCCTGCCCGG + Intergenic
1164256589 19:23533456-23533478 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1164256611 19:23533502-23533524 GTGGGGGGGCAGCCCCCGCCCGG - Intronic
1164301221 19:23964322-23964344 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1164301243 19:23964368-23964390 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1164301266 19:23964414-23964436 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1164301288 19:23964460-23964482 GGTGGGGGCCAGCCCCCGCCCGG + Intergenic
1164659241 19:29948996-29949018 GGCGGGGGGCAGCCCCCGCCTGG - Intronic
1164659263 19:29949042-29949064 GGCGGGGGGCAGCCCCCGCCCGG - Intronic
1164989895 19:32675795-32675817 AGGGGGTGGCAGCTCCGGCCGGG + Exonic
1165199480 19:34132872-34132894 TGGGGGGGTCAGCCCCCGCCAGG + Intergenic
1165481853 19:36069111-36069133 GGGGGGAGTCAGCCCCCGCCCGG - Intronic
1165481875 19:36069160-36069182 GGTGGGGGTCAGCCCCCGCCCGG - Intronic
1165768289 19:38364131-38364153 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1165852085 19:38855684-38855706 TGGGGGGGTCAGGCCCCGCCCGG - Intergenic
1166000891 19:39876876-39876898 AATGGGGGTCACCCCACGCCTGG + Exonic
1166003672 19:39893129-39893151 AATGGGGGTCACCCCACGCCTGG + Exonic
1166191966 19:41181104-41181126 TGGGGGGGACAGCCCCCGCCCGG + Intergenic
1166375328 19:42324353-42324375 AGTGGGGGGGAGGCTGCGCCCGG - Intronic
1166418018 19:42610480-42610502 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1166421334 19:42639421-42639443 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1166421399 19:42639564-42639586 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1166421420 19:42639611-42639633 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1166531958 19:43548108-43548130 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1166611732 19:44204191-44204213 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1166640231 19:44489054-44489076 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
1167145870 19:47680661-47680683 TGTGGGGGGCAGCGGCCGCCAGG - Exonic
1167269334 19:48498813-48498835 AGCGGGAGGTGGCCCCCGCCCGG + Exonic
1167287603 19:48607290-48607312 AGTGGGGGCCACCACCAGCCTGG + Exonic
1167540923 19:50086621-50086643 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1167907790 19:52676499-52676521 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1168213486 19:54908604-54908626 GTTGGGGGGCAGCCCCCGCCCGG - Intronic
925027928 2:624253-624275 AGGTGGGTGCAGTCCCCGCCTGG - Intergenic
925180767 2:1815632-1815654 AGTGTGGGGGAGCACCCCCCTGG + Intronic
925404081 2:3594884-3594906 GGTGGGGGGCAGGACCCTCCTGG - Intronic
925407500 2:3615796-3615818 GGTGGGGGGCAGCCCCTGCCTGG - Intronic
925407520 2:3615842-3615864 GGTGGGGGGCAGCCCCTGCCCGG - Intronic
925407541 2:3615888-3615910 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
926252737 2:11165149-11165171 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
926322610 2:11759802-11759824 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
926322633 2:11759849-11759871 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
926675037 2:15612176-15612198 GGTGGGGGTCACCCACCGCCAGG - Intronic
927776998 2:25910657-25910679 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
927849438 2:26489652-26489674 AGTGGGGAGCAGCCCCTGGCCGG - Intronic
927877159 2:26665531-26665553 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
928090237 2:28369325-28369347 AGAGAGGGGCAGCCCCAGCTGGG - Intergenic
928542157 2:32294156-32294178 GGTGGGGGTCAGCCCCTGCCAGG - Intronic
928585471 2:32754762-32754784 GGGGGAGGTCAGCCCCCGCCCGG - Intronic
928722148 2:34133131-34133153 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
928888872 2:36180263-36180285 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
929065000 2:37963978-37964000 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
929065022 2:37964024-37964046 GGTGGGGGGCAGCCCCCGCCAGG - Intronic
929110698 2:38403562-38403584 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
929151897 2:38755921-38755943 GTAGGGGGTCAGCCCCCGCCCGG - Intronic
929151918 2:38755968-38755990 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
929416035 2:41746988-41747010 AGGGGGGGTCAGCCCCCGCCCGG + Intergenic
929577751 2:43063184-43063206 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
929690279 2:44067465-44067487 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
930396346 2:50828358-50828380 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
930590806 2:53323659-53323681 GGTGCGGGGCAGCCCCCGCCCGG - Intergenic
930665541 2:54095993-54096015 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
930833818 2:55773602-55773624 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
931479929 2:62630401-62630423 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
931479952 2:62630447-62630469 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
931479975 2:62630493-62630515 GGTGGGGGGCAGCGCCCCCCCGG + Intergenic
931480018 2:62630585-62630607 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
931576460 2:63722609-63722631 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
931630821 2:64296880-64296902 GGTGGGGGGCTGCCCCTGCATGG + Intergenic
932410224 2:71542989-71543011 GGTGGGGGGCAGCCCCCGTCCGG - Intronic
932410247 2:71543035-71543057 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
932716167 2:74101791-74101813 GGTGGCGTGCAGCTCCCGCCGGG - Exonic
932718992 2:74124167-74124189 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
932807507 2:74796159-74796181 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
933174884 2:79164086-79164108 AGTGTGGGGTAACCCCCTCCAGG - Intergenic
934128389 2:88920736-88920758 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
934128761 2:88926229-88926251 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
934564398 2:95330347-95330369 ACTGGGGAGCAGCCCCAGCCAGG - Intronic
934573501 2:95385920-95385942 CGTGGGAGGCAGACCCCTCCTGG - Exonic
934998463 2:98988795-98988817 GGTGGGGGTCAGCCCCCGCCCGG - Intergenic
934998485 2:98988841-98988863 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
934998507 2:98988888-98988910 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
936013018 2:108936995-108937017 TGTGGGGGGCCTCCCCTGCCTGG - Intronic
936075084 2:109396711-109396733 TGTGGGGGACAGGCCCCTCCTGG + Intronic
937325728 2:120988761-120988783 AGGCGGGCGCAGCCCCCGCGTGG - Exonic
937445743 2:121956295-121956317 AGTGGGGGGCAGCCCACTTGGGG + Intergenic
938082344 2:128376865-128376887 AGTGGCGAGCAGCCCTCACCAGG - Intergenic
938250129 2:129808166-129808188 GGTTGGGGGAAGCCTCCGCCCGG - Intergenic
938253408 2:129833646-129833668 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
938720668 2:134064198-134064220 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
938720737 2:134064344-134064366 TGGGGGGGTCAGCCCCCACCCGG + Intergenic
938829063 2:135033864-135033886 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
938852478 2:135275241-135275263 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
938852501 2:135275287-135275309 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
938852522 2:135275333-135275355 GGTGGGGGTCAGCCCCCGCCTGG - Intronic
939477278 2:142702627-142702649 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
939578566 2:143922299-143922321 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
939670176 2:145001451-145001473 TGTGAGGGGAAGCCCCTGCCGGG + Intergenic
940299165 2:152160555-152160577 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
940643764 2:156369503-156369525 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
940852321 2:158700263-158700285 AGTGGGAACCAGCCCCGGCCAGG - Intergenic
941025160 2:160449200-160449222 GGTGGGGGGCAGCCCCCGCCAGG + Intronic
941197614 2:162470573-162470595 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
941477958 2:165971625-165971647 AGTGGGGTGCAGCCCACGGAGGG + Intergenic
941793326 2:169575375-169575397 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
941822322 2:169855965-169855987 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
941956459 2:171210448-171210470 GGTGGGGAGCAGCCCCAGCCAGG - Intronic
942012219 2:171774856-171774878 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
942012240 2:171774902-171774924 GGTGGGGGCCAGCCTCTGCCCGG + Intergenic
942021002 2:171866802-171866824 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
942096204 2:172538037-172538059 GGTGGGGGTCAGCCACCGCCAGG + Intergenic
942355702 2:175108414-175108436 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
942355724 2:175108461-175108483 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
942355747 2:175108508-175108530 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
943100352 2:183479332-183479354 GATGGGGGGCAGCCCCCGCCCGG + Intergenic
943100374 2:183479378-183479400 GGTAGGGGGCAGCCCCCGCCCGG + Intergenic
943578064 2:189653719-189653741 GGTGGGGGACAGCCCCCGCCCGG + Intergenic
943578106 2:189653811-189653833 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
943578128 2:189653857-189653879 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
943648288 2:190430833-190430855 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
943863236 2:192894319-192894341 AGTGGGGGGCAGCCCCCACCTGG + Intergenic
944060736 2:195568054-195568076 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
944144020 2:196486580-196486602 TGTGGGTGGCAGCCCTCCCCTGG + Intronic
944262473 2:197692818-197692840 ACTGGGAGGCACCCCCCACCAGG - Intergenic
944263101 2:197696497-197696519 GGGGGGGGTCAGCCCCCGCCCGG - Intronic
944266227 2:197729675-197729697 ACTGGGAGGCACCCCCCACCAGG + Intronic
944570859 2:201042696-201042718 GCTGGGGGGCAGCCCCCGCCCGG + Intronic
944585092 2:201166201-201166223 GTGGGGGGTCAGCCCCCGCCCGG - Exonic
944585115 2:201166248-201166270 CGTGGGGGTCAGCCCCCGCCCGG - Exonic
944625251 2:201563181-201563203 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
944751545 2:202715244-202715266 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
944751567 2:202715291-202715313 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
945114908 2:206400855-206400877 TGGGGGGGTCAGCCTCCGCCCGG - Intergenic
945114981 2:206401030-206401052 TGGGGGGGTCAGCCTCCGCCCGG - Intergenic
945316625 2:208377534-208377556 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
945316646 2:208377581-208377603 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
945530827 2:210950923-210950945 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
946240128 2:218348925-218348947 AGGGGGGGACAGCCCCCGCCCGG - Intergenic
946447311 2:219751128-219751150 GGTGGGGGGCCGCCCCGTCCGGG - Intergenic
946447331 2:219751170-219751192 GGTGGGGAGCAGCCCCTGCCCGG - Intergenic
947402356 2:229742964-229742986 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
947402423 2:229743109-229743131 TGGGGGGGTCAGCCCCCGCCAGG + Intergenic
947810497 2:233001047-233001069 GATGGGGGGAAGCCCCCTCCAGG - Intronic
948155824 2:235780099-235780121 TGGGAGGGGCAGCCCCCCCCAGG - Intronic
948589141 2:239038449-239038471 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
948651632 2:239449546-239449568 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
948689111 2:239690875-239690897 AGTGAGCGGCAGAGCCCGCCCGG - Intergenic
948706412 2:239795946-239795968 GTTGGGGGTCAGCCCCCACCCGG + Intronic
948706436 2:239795994-239796016 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1168741026 20:191608-191630 AGTGTGGGGTAACCCCCTCCAGG - Intergenic
1168851720 20:981628-981650 AGTTGGGGACAGTCCCTGCCAGG + Intronic
1168965424 20:1895322-1895344 AGTCGGGGGGAGGCCCAGCCGGG + Intronic
1169370854 20:5027716-5027738 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1169441759 20:5639285-5639307 GGTGGGGGGCAGCCGCCCCCCGG - Intergenic
1169885568 20:10394886-10394908 GGTGGGGATCAGCCCCCGCCCGG - Intergenic
1169885588 20:10394932-10394954 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
1169991885 20:11513392-11513414 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1170202607 20:13760756-13760778 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1170645728 20:18194659-18194681 GGTGGGGGTCAGCCCCCACCCGG + Intergenic
1170645750 20:18194707-18194729 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1170664566 20:18375697-18375719 GGTGGGGGGCAGCCCCCGCCGGG - Intergenic
1171237239 20:23536850-23536872 GATGGGGGACAGCCCCAGCCAGG + Intergenic
1171366106 20:24626205-24626227 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1171463682 20:25312961-25312983 GGTGGGGGCCAGCCCCCGACCGG + Intronic
1171496858 20:25561899-25561921 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1171791167 20:29526618-29526640 ACTGGGAGGCAGCCCCAGCAGGG + Intergenic
1171848371 20:30291600-30291622 GGGGGGGGTCAGCCCCCGCCCGG - Intergenic
1171848392 20:30291646-30291668 GGTGGGGGTCGGCCACCGCCCGG - Intergenic
1171848415 20:30291692-30291714 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1171848436 20:30291739-30291761 GGTGGGGGTCGGCCACCGCCCGG - Intergenic
1171848458 20:30291785-30291807 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1171861269 20:30405084-30405106 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1171899879 20:30847108-30847130 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
1171957377 20:31471350-31471372 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1172199633 20:33115788-33115810 GATGGGGGTCAGCCCCCGCCAGG + Intergenic
1172237754 20:33389490-33389512 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
1172237776 20:33389538-33389560 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1172237797 20:33389583-33389605 AGTAGGGGGCAGCCCCCGCCCGG + Intronic
1172258044 20:33536464-33536486 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1172279334 20:33699360-33699382 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1172279982 20:33701595-33701617 GGTGGGGGTCAGCCCCCGCCCGG + Intergenic
1172337940 20:34132694-34132716 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1172349905 20:34230758-34230780 CGGGGGGGTCAGCCCCGGCCAGG - Intronic
1172401994 20:34658899-34658921 GGTGGGGGTCAACCCCCGCCAGG + Intronic
1172722805 20:37012690-37012712 GGTGGGGGTCAACCCCCGCCAGG + Intronic
1172739050 20:37151144-37151166 AGGTGGGGGGCGCCCCCGCCCGG + Intronic
1172739069 20:37151184-37151206 AGGTGGGGGGCGCCCCCGCCCGG + Intronic
1172739088 20:37151224-37151246 AGGTGGGGGGTGCCCCCGCCTGG + Intronic
1172797434 20:37550718-37550740 GGTGGGGGGCAGCCCCCCCCCGG - Intergenic
1172910840 20:38407713-38407735 GGTGGGGGGCAGCCCCCGTCCGG + Intergenic
1172918542 20:38461670-38461692 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1172923828 20:38511946-38511968 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1173508415 20:43607299-43607321 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1175647184 20:60684682-60684704 AGTGGAGGGCAGCCCCCAGGAGG - Intergenic
1175775576 20:61651499-61651521 AGGTGCGGTCAGCCCCCGCCTGG + Intronic
1175775889 20:61653554-61653576 GGTGGGGGTCAGCCCCCGCCTGG - Intronic
1176030743 20:63009967-63009989 AGCGGGAGGGAGCCCCCGCTGGG + Intergenic
1176150003 20:63585932-63585954 TGAGGGGTGCAGCCCCCTCCAGG + Intergenic
1176209039 20:63908475-63908497 AGTGGGGTGGAGCCGCAGCCAGG + Intronic
1176306056 21:5123687-5123709 TGTGGGTGGCAGCCCCAGCACGG - Intronic
1176454782 21:6898795-6898817 AGTGGAGTGCACCCCCAGCCAGG + Intergenic
1176832954 21:13763843-13763865 AGTGGAGTGCACCCCCAGCCAGG + Intergenic
1177138111 21:17328208-17328230 ACTGGGAGGCACCCCCCGGCAGG + Intergenic
1177178393 21:17720350-17720372 GGGGGGGGTCAGCCCCTGCCTGG - Intergenic
1178034425 21:28564116-28564138 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1178665852 21:34545545-34545567 AGTGGGGGGCTGGCCAGGCCAGG + Intronic
1178873129 21:36392541-36392563 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1179411966 21:41168757-41168779 GGAGGACGGCAGCCCCCGCCCGG + Intronic
1179646349 21:42778552-42778574 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1179803371 21:43822408-43822430 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1179851001 21:44138344-44138366 TGTGGGTGGCAGCCCCAGCACGG + Intronic
1179969202 21:44824948-44824970 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1180181601 21:46120750-46120772 CTTGGGGTGCAGCACCCGCCTGG - Intronic
1180861353 22:19084666-19084688 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
1180861375 22:19084713-19084735 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1180861398 22:19084760-19084782 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
1180861421 22:19084806-19084828 GGTGGGGGGGCGCCTCCGCCCGG + Intronic
1181273933 22:21676973-21676995 GGTGGGGGGCAGCCCCCGCCTGG - Intronic
1181273954 22:21677019-21677041 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1181296991 22:21847778-21847800 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1181297011 22:21847820-21847842 GGTGGGGGGCACCCCCCGCCCGG + Intronic
1181310039 22:21939700-21939722 AGTGAGGGGCAGCCCCCAGCAGG + Intronic
1181617523 22:24065134-24065156 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1181776253 22:25161865-25161887 AGTGGGAGGCATGCCCAGCCAGG - Intronic
1182029115 22:27143646-27143668 AGTGGGGAGCTGCCACCCCCAGG - Intergenic
1182184901 22:28392121-28392143 ACTGGGAGGCATCCCCCACCAGG - Intronic
1182199423 22:28553701-28553723 GTGGGGGGTCAGCCCCCGCCAGG + Intronic
1182289146 22:29265515-29265537 GGTGGGGGCCGGCCCCGGCCTGG - Exonic
1182331140 22:29552527-29552549 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1182331164 22:29552573-29552595 GGTGGGGGCCAGCCCCAGCCCGG + Intronic
1182377371 22:29858140-29858162 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1182399843 22:30066885-30066907 GGTGGGAGGCAGCCCCCGCCCGG + Intergenic
1182484521 22:30631621-30631643 GGTGGGGGTCAGCCCCCGCCCGG - Intergenic
1182563927 22:31183962-31183984 AGCTCGGGGCAGCCCCCGCCTGG - Intronic
1182563944 22:31184003-31184025 GGGGGGGGGCAGCCCCCGCCCGG - Intronic
1182563967 22:31184048-31184070 AGGGAGGGGCAGCCCCCGACCGG - Intronic
1182563987 22:31184090-31184112 GGTGGTGGGCAGCCCCCGCCCGG - Intronic
1182976282 22:34626137-34626159 GTGGGGGGTCAGCCCCCGCCAGG - Intergenic
1182976303 22:34626184-34626206 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1182982417 22:34684407-34684429 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1183459389 22:37940845-37940867 AGTTGGGGACTGCCCCCTCCTGG + Exonic
1183571570 22:38656887-38656909 AGAGGAGGGCGGCCACCGCCCGG - Intronic
1183646860 22:39132073-39132095 ATTGGGGGACAGTCCCCTCCGGG - Exonic
1183784532 22:40021796-40021818 GGGGGGAGGCCGCCCCCGCCAGG + Exonic
1184201344 22:42971753-42971775 GGTGGGGGGTAGCCCCCGCCCGG + Intronic
1184201367 22:42971799-42971821 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1184201407 22:42971887-42971909 GGTGGGGGGCAGCCTCCACCCGG + Intronic
1184690158 22:46113826-46113848 GGTGGGGGGCAGCCCTCCCGTGG - Intronic
1184775233 22:46619812-46619834 AGTGGGCCCCAGCCCCCACCTGG - Intronic
1185385676 22:50530453-50530475 CGTGTGGGGCCGCTCCCGCCTGG + Exonic
949569976 3:5283893-5283915 GGTGGGGGTCAACCCCCGCCAGG - Intergenic
949841574 3:8325949-8325971 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
949853411 3:8440121-8440143 GGTGGGGGTCACCCACCGCCAGG + Intergenic
949883598 3:8678892-8678914 GGAGGGAGGCACCCCCCGCCAGG + Intronic
949992682 3:9592121-9592143 GGTGGGGGTCAGCCCCCGCCTGG + Intergenic
950060858 3:10070328-10070350 GGTGGGGGTCAGGCCCCGCCAGG + Intronic
950566829 3:13774370-13774392 ACTGGTGGTCAGCCCCAGCCAGG - Intergenic
950742426 3:15062042-15062064 GTTGGGGGTCAGCCCCCGCCAGG + Intronic
951247595 3:20359153-20359175 AGTGGGAGGCACCCCCCGGTAGG - Intergenic
951264185 3:20547947-20547969 AGGTGGGGGGCGCCCCCGCCCGG - Intergenic
951290454 3:20866921-20866943 GGTGGGGGTCAGCCCCCGCCTGG - Intergenic
951544487 3:23810823-23810845 AGCGGTGGGCTGCCACCGCCCGG - Intronic
951550498 3:23871502-23871524 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
951919539 3:27839141-27839163 AGTGTGGGGCTGCCCCAGCATGG + Intergenic
952308895 3:32169880-32169902 GGTGGGGGTCAGCCCTTGCCAGG + Intergenic
952364719 3:32664261-32664283 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
952892645 3:38053572-38053594 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
952894000 3:38064629-38064651 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
952934886 3:38389566-38389588 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
953037825 3:39227924-39227946 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
953322253 3:41983180-41983202 AACGGGGGTCAGCCCCCGCCCGG - Intergenic
953652744 3:44821293-44821315 GGTGGGGGTCACCCACCGCCAGG - Intronic
953844166 3:46414125-46414147 GGTGGGTGGCAGCCCCGGCCAGG + Intergenic
953913866 3:46905921-46905943 AGTGGAGGCCAGCCCTGGCCTGG - Intergenic
953922844 3:46964282-46964304 GGTGGGGGTCAGCCCCCGCCCGG + Intronic
953922867 3:46964329-46964351 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
953959516 3:47256470-47256492 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
953961340 3:47268385-47268407 GGTGGGGGACAGCCCCCCCTGGG + Intronic
954060347 3:48061744-48061766 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
954060370 3:48061790-48061812 GGTGGGGGGCAGCCCCCACCCGG + Intronic
954060393 3:48061836-48061858 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
954080680 3:48211440-48211462 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
954162804 3:48734462-48734484 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
954481231 3:50803689-50803711 GGTGGGGGGCAGCCCCCGCCTGG - Intronic
954481253 3:50803735-50803757 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
954481293 3:50803827-50803849 GGTGGGGGGCAGCCCCAACCCGG - Intronic
954481314 3:50803873-50803895 GGTGGGGGACAGCCCCCGCCCGG - Intronic
954566989 3:51607876-51607898 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
954567010 3:51607918-51607940 GGAGGGGGGCAGCCCCCGCCCGG - Intronic
954567031 3:51607960-51607982 GGTGGGGGGCAGCCCCCACCCGG - Intronic
955172884 3:56583960-56583982 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
955172931 3:56584053-56584075 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
955172954 3:56584099-56584121 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
955172978 3:56584145-56584167 GGTGGGGGGCCGCCCCCGCCCGG - Intronic
955348110 3:58175729-58175751 AAGGGAGGGCAGCCCCCGACAGG - Intergenic
955356755 3:58238066-58238088 AGGTGGGGGCAGCGCCCGCGCGG - Intronic
955363002 3:58290333-58290355 GTGGGGGGTCAGCCCCCGCCAGG - Intronic
956076373 3:65510016-65510038 ACTGGGAGGCAGCCCCCAGCAGG + Intronic
956468570 3:69542339-69542361 AGAGGAAGGCAGCCGCCGCCGGG - Intronic
956487709 3:69739848-69739870 AGTTGGGGGCCGCGCCTGCCCGG + Intronic
956789884 3:72672349-72672371 GGTGGGGGGAAGCCCCCTCTTGG + Intergenic
957620150 3:82584693-82584715 GGTGGGGGTCAGCCCCCACCCGG + Intergenic
957620172 3:82584740-82584762 GTGGGGGGTCAGCCCCCGCCTGG + Intergenic
957620293 3:82585022-82585044 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
957789302 3:84918897-84918919 GTAGGGGGTCAGCCCCCGCCCGG + Intergenic
958560917 3:95745338-95745360 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
958638430 3:96775875-96775897 AGTGGGCGGCAGGTCCCGTCAGG + Intergenic
958957455 3:100478073-100478095 GGTGGGGGTCAGCCCCCACCCGG - Intergenic
959042640 3:101439400-101439422 TGGGGGGGCCAGCCCCCCCCCGG + Intronic
959201666 3:103254990-103255012 GGTGGGGGTCAGCCCCCACCCGG - Intergenic
959415205 3:106073731-106073753 TGGGGGGATCAGCCCCCGCCTGG - Intergenic
959415251 3:106073827-106073849 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
959415348 3:106074049-106074071 TGGGGGGGTCAGCCCCCACCCGG - Intergenic
959415546 3:106074516-106074538 TGGGGGGATCAGCCCCCGCCTGG - Intergenic
959419312 3:106111765-106111787 GTAGGGGGGCAGCCCCCGCCTGG - Intergenic
959419393 3:106111967-106111989 TGGGGGGGTCAGCCCCCGCCTGG - Intergenic
959419437 3:106112062-106112084 TGGGGGGGGCAGCCCCCGTCCGG - Intergenic
960526671 3:118718516-118718538 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
960577533 3:119242786-119242808 GTGGGGGGGCAGCCCCCGCCTGG + Intergenic
960577552 3:119242828-119242850 AGTGGGGGGCAGCCCCCGCCCGG + Intergenic
960770751 3:121190713-121190735 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
960866049 3:122201618-122201640 GGTGGGGGGTCGCCCCCGCCCGG - Intronic
960866071 3:122201664-122201686 GGTGGGGGTCAGCCCCCGCCTGG - Intronic
960924309 3:122780496-122780518 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
961389367 3:126543074-126543096 AGTGGAAGGCAGCTCCCACCTGG - Exonic
961498117 3:127309076-127309098 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
961704454 3:128773422-128773444 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
961784475 3:129339929-129339951 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
962572202 3:136723558-136723580 AGTGGGGGTCAGCCCCCGCCAGG + Intronic
962688830 3:137872858-137872880 GTGGGGGGGCAGCCCCCGCCCGG + Intergenic
962688852 3:137872904-137872926 GGTGGGGGGCAGCCCCCGGCCGG + Intergenic
962787946 3:138785096-138785118 GGTGGGGGGCAGCCCCCGCTCGG + Intronic
962787966 3:138785142-138785164 GATGGGGGGCAGCCCCCGCCCGG + Intronic
962787988 3:138785188-138785210 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
962788010 3:138785234-138785256 GGCGGGGGGAAGCTCCCGCCCGG + Intronic
962844249 3:139261134-139261156 AATGAGGCACAGCCCCCGCCTGG + Intronic
963776389 3:149445032-149445054 GGTGGGGGGCAGCCCCCACCTGG - Intergenic
963888085 3:150603284-150603306 AGTGGGGAGCAGCTCGCTCCTGG + Exonic
963911333 3:150820414-150820436 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
964367156 3:155962317-155962339 GGCGGGGGGCAGCCTCCACCTGG - Intergenic
965302382 3:167018966-167018988 GGTGGGGGGCAGCCTCCGCCCGG + Intergenic
965302417 3:167019053-167019075 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
965650096 3:170923840-170923862 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
965757320 3:172039978-172040000 AGGCGGGGGCCGCCCCCTCCCGG - Intronic
966011730 3:175087235-175087257 GGTGGGGGGCAGCCCCTGCCCGG + Intronic
966015106 3:175131859-175131881 TGGGGGGGTCAGACCCCGCCCGG - Intronic
966015478 3:175132774-175132796 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
966206640 3:177412823-177412845 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
966206663 3:177412869-177412891 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
966351041 3:179032864-179032886 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
966359607 3:179120068-179120090 GGGGGGGGTCAGCCCCCGCCAGG + Intergenic
966617198 3:181925922-181925944 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
966806459 3:183811434-183811456 AGTGGGGAGCGGCGCCCGGCAGG + Exonic
967127227 3:186435414-186435436 GGTAGGGGGCAGCCCCCGCCCGG - Intergenic
967169396 3:186811717-186811739 GGTGGGGGTCAGCCCCCACCAGG - Intergenic
967578505 3:191125037-191125059 GGTGGGGGACAGCCCCCGCCCGG - Intergenic
967711290 3:192711238-192711260 GGTGGGGGCCAGCCCCTGCCCGG + Intronic
968156562 3:196385747-196385769 GGTGGGGGGCAGCCCCCACCCGG + Intronic
968316704 3:197731612-197731634 TGGGGGGGTCAGGCCCCGCCCGG - Intronic
968411729 4:395950-395972 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
968424034 4:509501-509523 AGTGGAAGGCAGCCGCCGACAGG - Intronic
968667275 4:1828546-1828568 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
968667487 4:1829029-1829051 TGGGGGGGTCAGCTCCCGCCCGG - Intronic
968852724 4:3094574-3094596 GGTGGTGGGCAGCCCCCGCCCGG - Intronic
968852743 4:3094616-3094638 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
968852765 4:3094658-3094680 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
968852786 4:3094700-3094722 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
969219666 4:5751670-5751692 TGTGAGGGGCAGTCCCAGCCTGG - Intronic
969326823 4:6448875-6448897 TGCTGGGGTCAGCCCCCGCCCGG - Intronic
969384733 4:6837123-6837145 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
969508313 4:7602289-7602311 GGTGGGGGACAGCCCCCGCCCGG - Intronic
971282021 4:25249429-25249451 GGCGGGGGGCAGCCCCCGCCCGG - Intronic
971282042 4:25249471-25249493 GGCGGGGGGCAGCCCCCGCCCGG - Intronic
971594812 4:28514906-28514928 GGTGGGGGTCAGCCCCCACCAGG - Intergenic
972173420 4:36375265-36375287 AGCGGGGGGCAGCGCTCGTCAGG - Intergenic
972412465 4:38807782-38807804 GGTGGGGGACAGCCCCCGCCAGG + Intronic
972551758 4:40141256-40141278 GGTGGGGGTCACCCACCGCCAGG - Intronic
972552576 4:40147575-40147597 TGGGGGGGTCAGCCCCCACCCGG - Intronic
972552600 4:40147623-40147645 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
972654176 4:41049460-41049482 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
972654198 4:41049506-41049528 GGTGGGGGCCAGCCCCCGCCCGG + Intronic
972938451 4:44167976-44167998 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
972939791 4:44182120-44182142 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
972939813 4:44182166-44182188 GGTGGGGGGGCGCCTCCGCCTGG + Intronic
973263407 4:48186717-48186739 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
973274419 4:48292629-48292651 GGCGGGGGGCAGCCCCCGCCCGG + Intergenic
973274465 4:48292723-48292745 GTAGGGGGGCAGCCCCCGCCCGG + Intergenic
973664125 4:53139585-53139607 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
973673048 4:53238295-53238317 TGGGGGGGTCAGCCCCCACCCGG - Intronic
973675206 4:53256054-53256076 GGTGGGGGTCAGCCCCCACCAGG - Intronic
974009302 4:56592702-56592724 GGTCGGGGGCGGCCGCCGCCTGG + Intronic
974021216 4:56693573-56693595 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
974082179 4:57224508-57224530 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
974597902 4:64037458-64037480 AGGTGGGGGGCGCCCCCGCCTGG + Intergenic
974870576 4:67637175-67637197 GTGGGGGGGCAGCCCCCACCCGG + Intronic
974870599 4:67637221-67637243 GGTGGGGGGCAGCACCCGTCTGG + Intronic
974870615 4:67637267-67637289 GGTGGAGGGCAGCCCCTGCCCGG + Intronic
974870636 4:67637313-67637335 GGTGGGGGCCAGCCCCCACCTGG + Intronic
975063842 4:70037775-70037797 GGTGGGGGGCAGCCCCCACCTGG + Intergenic
975063863 4:70037821-70037843 GGTGGGGGGCAGCCCCTGCCGGG + Intergenic
975522682 4:75317755-75317777 AAGCGGGGGCAGCCCCTGCCTGG + Intergenic
975522718 4:75317837-75317859 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
975793675 4:77983930-77983952 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
976149450 4:82077940-82077962 GGTGGGGGACAGCCCCCGCCCGG + Intergenic
977678160 4:99770721-99770743 ACTGGGAGGCACCCCCCGGCAGG - Intergenic
978014283 4:103723410-103723432 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
978224939 4:106321575-106321597 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
978519791 4:109603764-109603786 AGGTGGGGGGCGCCCCCGCCCGG + Intronic
979273739 4:118792268-118792290 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
980883701 4:138739509-138739531 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
981677483 4:147358063-147358085 GTGGGGGGTCAGCCCCCGCCAGG + Intergenic
981993709 4:150954144-150954166 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
981994897 4:150964123-150964145 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
982022233 4:151214800-151214822 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
982075326 4:151731912-151731934 GGTGGGGGTCAGCCCCCGCCGGG + Intronic
982075369 4:151732006-151732028 GTGGGGGGTCAGCCCCCGCCCGG + Intronic
982075393 4:151732054-151732076 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
982075416 4:151732099-151732121 AGGTGGGGGGAGCCTCCGCCCGG + Intronic
982182848 4:152765334-152765356 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
982191973 4:152866486-152866508 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
982191995 4:152866534-152866556 GGTGGGGGTCAGCCCCCGCGCGG - Intronic
982192016 4:152866580-152866602 GGTGGGGGTCAGCCCCCGCCCGG - Intronic
982192033 4:152866626-152866648 GGTGGGGGTCAGCCCCCACCAGG - Intronic
982440121 4:155424968-155424990 GGTTGGGGGCAGCCCCCGCCCGG - Intergenic
982709687 4:158746646-158746668 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
982723520 4:158882331-158882353 GGTGAGGGGCAGCCCCCGTCCGG + Intronic
982784221 4:159523318-159523340 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
983218067 4:165019953-165019975 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
983218115 4:165020077-165020099 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
983604588 4:169570358-169570380 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
983613717 4:169679028-169679050 AGGTGGGGGGCGCCCCCGCCCGG - Intronic
983664415 4:170166250-170166272 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
983664434 4:170166292-170166314 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
983905980 4:173183728-173183750 GGTGGGGGGCAGACCCCGCCCGG - Intronic
983905998 4:173183770-173183792 GGTGGGGGGCAGTCCCTGCCAGG - Intronic
983906015 4:173183812-173183834 GGTGGGGGACAGTCCCCGCCCGG - Intronic
984004922 4:174295116-174295138 GGTGAGGGTCAGCCCCCGCCAGG - Intronic
984029635 4:174586851-174586873 GGTTGGGGGCGGCCCTCGCCCGG - Intergenic
984029657 4:174586897-174586919 GGTGGGGGCCAGCCCCCGGCCGG - Intergenic
984037905 4:174692218-174692240 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
984803538 4:183735358-183735380 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
984803855 4:183736098-183736120 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
985216400 4:187658242-187658264 GGTGGGGGTCAGCCCCCGCCCGG + Intergenic
985712178 5:1435725-1435747 AGTGGTGGCCAGTCCCCTCCTGG + Intronic
985712254 5:1435986-1436008 AGTGGTGGCCAGTCCCCTCCTGG + Intronic
985996037 5:3597348-3597370 CCTGGGAGGCAGCCCCCTCCTGG + Intronic
987469318 5:18309832-18309854 GGTGGGGATCAGCCCCTGCCCGG + Intergenic
989068144 5:37483762-37483784 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
989211554 5:38862408-38862430 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
989252706 5:39334518-39334540 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
989372342 5:40722815-40722837 TGGGGGGCGCAGCCCCCACCCGG + Intronic
989379704 5:40800547-40800569 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
989379729 5:40800596-40800618 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
989574785 5:42979555-42979577 AGGTGGGGGCAGCCCCAGCCCGG + Intergenic
989587984 5:43088287-43088309 GGGGGGGGTCAGCCCCCGCCCGG - Intronic
989633534 5:43511363-43511385 GGTGGGGGGCAGCCCCGACCCGG + Intronic
989640427 5:43578279-43578301 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
989648762 5:43665843-43665865 GATGGGGGGCAGCCCCTGCCCGG - Intronic
989655797 5:43745903-43745925 GGTGGGGGCCAGCCCCCACCCGG - Intergenic
989655833 5:43745986-43746008 GGTTGGGGGCAGCCCCCACCCGG - Intergenic
989663449 5:43824539-43824561 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
989732941 5:44669226-44669248 ACTGGGAGGCACCCCCCGGCAGG + Intergenic
989828886 5:45890762-45890784 GGTGGGGAGCAGCCCTTGCCTGG + Intergenic
989828903 5:45890808-45890830 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
989828925 5:45890854-45890876 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
989828946 5:45890900-45890922 AGTGGGGGGCAGCCCCCACCCGG + Intergenic
989828967 5:45890946-45890968 GGTGGGGGCCAGCCCCTGCCTGG + Intergenic
990293938 5:54381609-54381631 ATGGGGGGTCAGCCCCCACCCGG + Intergenic
990501042 5:56397784-56397806 AGGTGGGGGCAGCCCCTGCCTGG - Intergenic
990501062 5:56397829-56397851 GGTGGGGGGCAGCCCCCGCCAGG - Intergenic
991127355 5:63083833-63083855 GGTGGGGGTCAGCCCCCGCCCGG - Intergenic
991672606 5:69062980-69063002 GTGGGGGGTCAGCCCCCGCCAGG - Intergenic
991910086 5:71551989-71552011 GGTGGGGGTCAGCCCTCGCCAGG - Intronic
992289657 5:75270446-75270468 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
992391669 5:76336138-76336160 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
992415759 5:76550973-76550995 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
992443009 5:76812471-76812493 GGTGGGGGTCAGCCCCCACCAGG + Intergenic
992463789 5:76985107-76985129 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
992469678 5:77042800-77042822 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
992574485 5:78096837-78096859 GGGGGGGCTCAGCCCCCGCCAGG + Intronic
992600221 5:78391446-78391468 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
992675364 5:79101167-79101189 ACTGGGAGGCAGCCCCCAGCAGG - Intronic
992852455 5:80824355-80824377 GGTGGGGGGCAGCCCCCACCCGG - Intronic
992852491 5:80824430-80824452 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
992914268 5:81432757-81432779 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
993162672 5:84312177-84312199 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
993162720 5:84312274-84312296 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
993934747 5:93986320-93986342 AGGTGGGGGGCGCCCCCGCCCGG + Intronic
994547116 5:101180850-101180872 ACTGGGAGGCAACCCCCGGCAGG + Intergenic
995123519 5:108559120-108559142 TGGGGGGGTCAGACCCCGCCCGG - Intergenic
995161820 5:108992668-108992690 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
995236170 5:109832758-109832780 GGTGGGGGGCAGCCCCGGCCCGG - Intronic
995994516 5:118282865-118282887 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
995994539 5:118282912-118282934 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
995994562 5:118282959-118282981 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
996054149 5:118965262-118965284 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
996386252 5:122913335-122913357 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
997321605 5:132983060-132983082 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
997636321 5:135409351-135409373 GGCGGTGGGCAGCCCCCGCCCGG + Intergenic
998021833 5:138776986-138777008 GTGGGGGGTCAGCCCCCGCCAGG - Intronic
998025252 5:138811006-138811028 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
998060092 5:139112631-139112653 GGTGGGGGCCAGCCCCCGCCCGG + Intronic
998067482 5:139170774-139170796 GGTGGGGGTCAGCCCTGGCCAGG + Intronic
998247005 5:140515658-140515680 ACTGGGGGGCACCCCCCAGCAGG + Intronic
999532570 5:152479855-152479877 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
999532591 5:152479897-152479919 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
999532613 5:152479943-152479965 GGTGGGGGGCAGCCCCCGGCCGG - Intergenic
999987035 5:157014369-157014391 GGTGGGGGTCAGCCCCCGCCCGG + Intergenic
999987058 5:157014416-157014438 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1000159180 5:158582663-158582685 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1000630192 5:163583674-163583696 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1000815678 5:165919337-165919359 CTAGGGGTGCAGCCCCCGCCCGG + Intergenic
1001444858 5:171775284-171775306 AGTGTGAGGCAGCGCCCTCCTGG - Intergenic
1002013791 5:176305356-176305378 GGGGGGGGTCAGCCCCCGCCTGG + Intronic
1002013812 5:176305404-176305426 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1002031602 5:176434066-176434088 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1002418373 5:179132597-179132619 AGTCGGGGACAGCCCCAGCTGGG - Intronic
1002471076 5:179436464-179436486 AGTGTGGGGCAGCCCCTGCTCGG + Intergenic
1002556498 5:180045997-180046019 AGCAGGGGGCAGCGCTCGCCGGG + Intronic
1004152513 6:13134157-13134179 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1004400197 6:15281569-15281591 AGTGGGGGGCCCCCCACGCGGGG - Intronic
1004664226 6:17735607-17735629 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1005606773 6:27484998-27485020 TGGGGGTGTCAGCCCCCGCCCGG - Intergenic
1005611527 6:27529986-27530008 GGTGGGGGGGGGGCCCCGCCCGG - Intergenic
1005611550 6:27530028-27530050 GGTCGGGGGCAGCCCCCGGCCGG - Intergenic
1005624918 6:27653724-27653746 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1005624937 6:27653766-27653788 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1005710923 6:28502416-28502438 GGTGGGGGGCAGCCTCTGCCCGG + Intergenic
1005860324 6:29895787-29895809 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1005860344 6:29895832-29895854 GGTGGGGGGCAGCCCCTGCCCGG - Intergenic
1005860366 6:29895878-29895900 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1005929845 6:30475309-30475331 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1006014139 6:31067220-31067242 GTGGGGGGGCAGCCCCCGCCCGG - Intergenic
1006055953 6:31384710-31384732 TGTGGCCGGCAGCCCCCGCAGGG + Intergenic
1006148269 6:31972043-31972065 AGTGGCGGGCAAACCCCTCCCGG + Exonic
1006209899 6:32385300-32385322 TGGGGGGGTCAGCCCCCTCCCGG - Intergenic
1006369327 6:33634247-33634269 AGTTGAGCGCAGCCCCCACCTGG - Intronic
1006546682 6:34786691-34786713 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1006623884 6:35384611-35384633 TGGGGGGGTCAGGCCCCGCCCGG + Intronic
1006623960 6:35384786-35384808 TGGGGGGGTCAGGCCCCGCCCGG + Intronic
1006631878 6:35435987-35436009 AGTTTCGGGCAGCCCCCTCCTGG + Intergenic
1006826872 6:36941811-36941833 GGTGGGGGGCAGCCACCGCCCGG + Intergenic
1006948432 6:37801161-37801183 AGGGAGGGGCAGCCCACTCCAGG + Intergenic
1007544959 6:42686695-42686717 GGTGGGGGGCAGCTCCCACCCGG - Intronic
1007544978 6:42686737-42686759 GGTGGGGGGCAGCCCCTACCCGG - Intronic
1007651502 6:43425327-43425349 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1008106294 6:47443970-47443992 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1008106315 6:47444016-47444038 GGTGGGGGGCAACCCCTGCCCGG - Intergenic
1008184337 6:48371343-48371365 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1008553721 6:52656049-52656071 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1008624724 6:53305366-53305388 GGGGGGGGTCAGCCCCCGCCAGG - Intronic
1008909861 6:56721009-56721031 CGGAGGGGGCTGCCCCCGCCCGG - Intronic
1008909898 6:56721094-56721116 GGTGGGGGGGCGCCCCCGCCCGG - Intronic
1008956457 6:57221748-57221770 GGTGGGCGGCAGCGCCAGCCCGG - Exonic
1009042075 6:58190895-58190917 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1009049092 6:58257913-58257935 GGTGGGGGTCAGCCCCCGCCCGG + Intergenic
1009217912 6:60945120-60945142 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1009913707 6:69966148-69966170 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1010264362 6:73851046-73851068 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1010264384 6:73851093-73851115 GGTGGGGGTCAGCCCCCGCCCGG - Intergenic
1010272035 6:73925914-73925936 GGTGGGGGGCAGCCCCCACCCGG - Intergenic
1010272054 6:73925956-73925978 GGTGGGGGGCAGCCCCCGCCTGG - Intergenic
1010300595 6:74255095-74255117 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1010379137 6:75206290-75206312 AGAGGGGGACAGCCGCAGCCGGG + Intergenic
1011107864 6:83803022-83803044 ACTGGGAGGCAGCCCCCAGCAGG - Intergenic
1011291410 6:85781161-85781183 GGTGGGGGGCAGCCCACGCCCGG + Intergenic
1011297274 6:85838815-85838837 GGTGGGGGTCAGCCCCCACCTGG + Intergenic
1011426719 6:87239338-87239360 GGTGGGGGGCAGCCCCCGCCTGG - Intronic
1011426763 6:87239430-87239452 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1011426785 6:87239476-87239498 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1011426807 6:87239522-87239544 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1011474161 6:87735956-87735978 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1011474184 6:87736002-87736024 GGTGGGGGGCAGCCCCCACCCGG - Intergenic
1011476079 6:87751213-87751235 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1012428728 6:99142243-99142265 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1012479338 6:99650193-99650215 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1012479361 6:99650240-99650262 GGTGGGGGTCAGCCCCCGCCCGG - Intergenic
1012899574 6:104991222-104991244 GGCAGGGGGCAGCCCCCGCCCGG - Intronic
1013530746 6:111017342-111017364 GGCGGGGGGCAGCCCCCGCCCGG - Intronic
1013681252 6:112528279-112528301 TGGGGGGGTCAGCCCCCACCCGG - Intergenic
1013681300 6:112528376-112528398 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1013955573 6:115836527-115836549 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1014463648 6:121729692-121729714 GGTGGGGGGCAGCCCCTGCCCGG - Intergenic
1014800376 6:125771024-125771046 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1015070575 6:129088514-129088536 GGTAGGGGGCAGCCCCCGCCTGG - Intronic
1015643542 6:135363756-135363778 TGGGGGGGTCAACCCCCGCCCGG - Intronic
1016123604 6:140373838-140373860 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1016476387 6:144433352-144433374 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1016973520 6:149786306-149786328 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1016973569 6:149786403-149786425 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1017063469 6:150507598-150507620 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
1017170395 6:151450355-151450377 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1017170440 6:151450450-151450472 TGGGGGGGCCAGCCCCCGTCCGG + Intronic
1017493766 6:154966316-154966338 GGTGGGGGTCAGCCCCCACCAGG - Intronic
1017660651 6:156670346-156670368 GGTGGGGGTCAGCCCCCCCCAGG + Intergenic
1017851495 6:158309020-158309042 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1017981937 6:159407522-159407544 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1017982004 6:159407660-159407682 GGTGGGGGGCAGCCCCTGCCCGG + Intergenic
1018295432 6:162339339-162339361 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1018528114 6:164736166-164736188 GGTGGGGGGCAGCCCCCACCCGG - Intergenic
1018979347 6:168590146-168590168 TTTAGGGGGCAGCCCCAGCCTGG + Intronic
1019312966 7:371699-371721 AGTGGGGGTCACCCCCCACCAGG - Intergenic
1019651577 7:2161928-2161950 GGTGGGGGGCAGCCCCCACCCGG + Intronic
1019656546 7:2199034-2199056 AGGGAGGGGCAGCCCCCTCCTGG - Intronic
1019674470 7:2303008-2303030 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1020284870 7:6671518-6671540 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1020326015 7:6975348-6975370 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1021168335 7:17368089-17368111 AGTGGAGGGCTGCCCTGGCCAGG + Intergenic
1021310498 7:19090002-19090024 AGTCAGGGGAAGCCCTCGCCAGG - Intronic
1021672366 7:23046316-23046338 GGGGGGGGTCAGACCCCGCCCGG - Intergenic
1021672459 7:23046543-23046565 GGTGGGAGTCAGCCCCCGCCAGG - Intergenic
1021991888 7:26148247-26148269 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1021991911 7:26148294-26148316 CTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1021991934 7:26148341-26148363 CTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1021991957 7:26148388-26148410 CTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1022005516 7:26262349-26262371 TGGGGGGGTCAGCCCCTGCCCGG + Intergenic
1022005538 7:26262396-26262418 TGGGGGGGTCAGCCCCTGCCCGG + Intergenic
1022187896 7:27987477-27987499 GGTTGGGGGCAGCCCCCACCCGG + Intronic
1022187914 7:27987519-27987541 GGTCGGGGGCAGCCCCTGCCCGG + Intronic
1022187935 7:27987565-27987587 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1022318126 7:29263926-29263948 GCTGGGGGGCAGCCCCCGCCCGG + Intronic
1022318182 7:29264036-29264058 GGTGGGGGGCAGCCCCCATCCGG + Intronic
1022700374 7:32754072-32754094 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
1022700394 7:32754117-32754139 AGGTGGGGCCAGCCCCTGCCTGG + Intergenic
1022700413 7:32754159-32754181 GGTGGGGGGCAGCCCCTGCCCGG + Intergenic
1024309866 7:47959648-47959670 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1024538716 7:50459783-50459805 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1024931275 7:54667943-54667965 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1025000616 7:55312081-55312103 GGTGGGGGTCAGCCCCGGCCAGG + Intergenic
1025011586 7:55402590-55402612 TGGGGGGGTCATCCCCCGCCTGG - Intronic
1025102913 7:56150665-56150687 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1025572977 7:62599817-62599839 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1025775177 7:64554367-64554389 GGTGGGGGGCAGCCCCAGCCCGG + Intronic
1025775195 7:64554409-64554431 GGTGGGGGGCAGCCCCCACCCGG + Intronic
1025793679 7:64718110-64718132 GGTGGGGGTCAGCCCCCGCCCGG + Intergenic
1025793701 7:64718156-64718178 GGTGGGGGTCAGCCCCCCCCAGG + Intergenic
1025808313 7:64856419-64856441 TGGGGGGGTCAGCCCCTGCCCGG + Intergenic
1025821363 7:64967650-64967672 GGGGGGGGTCAGCCCCCACCCGG - Intergenic
1025821564 7:64968131-64968153 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
1025829002 7:65033747-65033769 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1025979125 7:66393350-66393372 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1025979430 7:66394072-66394094 TGGGGGGGTCAGCCCCCGTCCGG - Intronic
1026008039 7:66614821-66614843 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1026008062 7:66614868-66614890 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1027182921 7:75952451-75952473 GGTGGGGGTCAGCCCCCGCCCGG - Intronic
1027188227 7:75984190-75984212 AGGTGGGGGCAGCCCCAGGCCGG - Intronic
1027371126 7:77509329-77509351 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1028160165 7:87475888-87475910 GGTGGGCGGCGGCCCCAGCCGGG - Intronic
1028430830 7:90744836-90744858 TGGGGGGGTCAGCCCCCGTCCGG - Intronic
1028595642 7:92544987-92545009 GGTGGGTGACAGCCCCCGCCTGG - Intergenic
1028685580 7:93586175-93586197 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1028983217 7:96989768-96989790 AGTGGGAGGCCGGCGCCGCCAGG - Intergenic
1029279489 7:99427082-99427104 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1029430109 7:100523739-100523761 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
1029439347 7:100578515-100578537 TGTGCGGGGCAGCACACGCCAGG + Intronic
1029525752 7:101092622-101092644 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1029689326 7:102170568-102170590 CGTGGGGGACTGTCCCCGCCTGG + Intronic
1030329399 7:108255957-108255979 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1030329420 7:108256002-108256024 AGGTGGGGGCAGCCCCCGCCCGG + Intronic
1030588148 7:111446419-111446441 ACTGGGAGGCAGCCCCCAGCAGG + Intronic
1030706327 7:112697309-112697331 GGCAGGGGGCAGCCCCCGCCCGG - Intergenic
1030725722 7:112922782-112922804 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1030905142 7:115173040-115173062 ACTGGGAGGCAGCCCCCAGCAGG - Intergenic
1031706301 7:124984742-124984764 ACTGGGAGGCAGCCCCCAGCAGG - Intergenic
1032028673 7:128463642-128463664 GGTGGGGGGGCGCCCCCGCCCGG + Intergenic
1032156827 7:129476180-129476202 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1032156850 7:129476226-129476248 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1033090261 7:138378969-138378991 AGGTGGGGGGCGCCCCCGCCCGG - Intergenic
1033294108 7:140115033-140115055 GGTTGGGGGCAGCCCCTGCTCGG + Intronic
1033294128 7:140115079-140115101 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1033433141 7:141307422-141307444 AGTGAGTGGCAGCCGCTGCCAGG - Intronic
1033945172 7:146707552-146707574 AGTGGAGTGCAGCCCAGGCCTGG - Intronic
1034224672 7:149473534-149473556 AGTGGGAGGCAGCCCCAGGTTGG + Exonic
1034233997 7:149554370-149554392 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1034303317 7:150034065-150034087 GGTGGGAGGCACCCCCCGCGAGG - Intergenic
1034304087 7:150037059-150037081 AGGGGGAGGCACCCCCCGCGAGG - Intergenic
1034304294 7:150037754-150037776 AGGGGGAGGCACCCCCCGCGAGG - Intergenic
1034304661 7:150039183-150039205 GGTGGGAGGCACCCCCCGCGAGG - Intergenic
1034304837 7:150039730-150039752 AGGGGGAGGCACCCCCCGCGAGG - Intergenic
1034305296 7:150041703-150041725 AGGGGGAGGCACCCCCCGCGAGG - Intergenic
1034723514 7:153315291-153315313 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1034801912 7:154060329-154060351 AGGGGGAGGCACCCCCCGCGAGG + Intronic
1034802449 7:154062324-154062346 AGGGGGAGGCACCCCCCGCGAGG + Intronic
1034802507 7:154062486-154062508 AGGGGGAGGCACCCCCCGCGAGG + Intronic
1034802565 7:154062648-154062670 AGGGGGAGGCACCCCCCGCGAGG + Intronic
1034802841 7:154063521-154063543 AGGGGGAGGCACCCCCCGCGAGG + Intronic
1034915394 7:155034672-155034694 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1034983994 7:155496398-155496420 GGTGGGGGGAAGTCCCCTCCTGG + Intronic
1035331123 7:158098177-158098199 AGCGTGGGGCAGCCTCTGCCTGG + Intronic
1035612029 8:973285-973307 GTGGGGGGACAGCCCCCGCCCGG - Intergenic
1037134565 8:15445940-15445962 GGTGGGGGGCAGCCCCCGTCCGG - Intronic
1037547697 8:19939967-19939989 ACTGCGGCTCAGCCCCCGCCCGG + Intronic
1037791361 8:21945223-21945245 CTTGGGGGGCAGCCCCCGCCCGG - Intronic
1038167970 8:25103178-25103200 GGTGGGGGGCAGGGCCAGCCCGG + Intergenic
1039153340 8:34529252-34529274 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1039488252 8:37928027-37928049 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1039488275 8:37928075-37928097 TTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1039650841 8:39339097-39339119 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1040041283 8:42919035-42919057 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1040041304 8:42919077-42919099 GATGGGGGGCAGCCCCCGCCCGG - Intronic
1040069557 8:43179229-43179251 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1040093241 8:43419416-43419438 TGGGGGGGTCAGCCCCCACCCGG - Intergenic
1040616238 8:49041509-49041531 GGTGGGGGGGTGCCCCCGCCCGG - Intergenic
1040616256 8:49041550-49041572 AGGTGGGGGGCGCCCCCGCCTGG - Intergenic
1040818681 8:51534354-51534376 GGGGGGGGTCAGCCCCCGCCAGG + Intronic
1040834607 8:51718942-51718964 GGCGGGGGGCAGCCCCCACCCGG + Intronic
1040834629 8:51718988-51719010 GGCGGGGGGCAGCCCCCGATCGG + Intronic
1041066302 8:54085809-54085831 GGGGGGGGGCAGCCCCCGGCCGG + Intronic
1041070773 8:54125394-54125416 GGGGGGGGTCAGCCCCCGTCCGG + Intergenic
1041070820 8:54125492-54125514 GGGGGGGGTCAGCCTCCGCCCGG + Intergenic
1041270417 8:56104584-56104606 GGTGGGGGTCAGCCCCTGCCAGG - Intergenic
1041523102 8:58776488-58776510 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1042134052 8:65616999-65617021 GGCGGGGGGCAGCCCCCGCCCGG + Intronic
1042290679 8:67167384-67167406 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1042290701 8:67167430-67167452 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1042912870 8:73845009-73845031 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1042912887 8:73845048-73845070 GGAGGTGGCCAGCCCCCGCCCGG + Intronic
1042912905 8:73845090-73845112 GGTGGGGGGCAGCCCCCGCCTGG + Intronic
1043958477 8:86389776-86389798 GGTGGGGGGCGGCCTCCGCCGGG - Intronic
1043958522 8:86389868-86389890 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1043961548 8:86423888-86423910 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1043961570 8:86423934-86423956 TTATGGGGGCAGCCCCCGCCCGG - Intronic
1043985980 8:86694389-86694411 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1044190468 8:89310344-89310366 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1044507642 8:93039438-93039460 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1044597186 8:93970656-93970678 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1044597207 8:93970702-93970724 GGTGGGGCACAGCCCCCGCCCGG - Intergenic
1044637399 8:94340900-94340922 GGAGGGGGCCAGCCCCTGCCCGG + Intergenic
1044637418 8:94340942-94340964 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1044637439 8:94340984-94341006 GGTGGGGGGCAGCCCCCGCCTGG + Intergenic
1044969468 8:97605218-97605240 GGTAGGGGGCAGCCCCCGCCCGG + Intergenic
1045021893 8:98051767-98051789 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1045195676 8:99927405-99927427 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1045524031 8:102928236-102928258 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1047168608 8:122467258-122467280 AGTGGGTGGGAGCCCCCTGCTGG - Intergenic
1047388560 8:124431959-124431981 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1047639654 8:126804899-126804921 ACTGGGGGGCACCCCCCAGCAGG - Intergenic
1048368415 8:133757770-133757792 GGTGGGGGTCAACCCCCGCCAGG + Intergenic
1049177308 8:141202167-141202189 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1049177328 8:141202214-141202236 GGTGGGGGTCAGCCCCCGCCGGG - Intergenic
1049177350 8:141202260-141202282 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1049177372 8:141202306-141202328 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1049177393 8:141202353-141202375 GTGGGGGGTCAGCCCCCGCCAGG - Intergenic
1049177414 8:141202399-141202421 GGTGGGGGTCAGCCCCCGCCCGG - Intergenic
1049481596 8:142826990-142827012 AGGTGGGGGGCGCCCCCGCCCGG - Intergenic
1049975978 9:861719-861741 GGTGGGGGGCAGCCCCTGCCCGG - Intronic
1050537780 9:6645433-6645455 GGTCGGGGGCGGCCGCCGCCTGG - Exonic
1051258101 9:15234259-15234281 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1051280898 9:15442052-15442074 GTTGGGGGGCAGCCCCTGCCTGG - Intronic
1051280920 9:15442099-15442121 GGTGGGGGGCAGCCCCCGCCTGG - Intronic
1051280963 9:15442191-15442213 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1051280986 9:15442237-15442259 GGTTGGGGGCAGCCCCCGCCCGG - Intronic
1051281007 9:15442283-15442305 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1052274878 9:26664551-26664573 GGTGGGGGGGCGCCCCCGCCAGG + Intergenic
1052410606 9:28117190-28117212 ACTGGGAGGCACCCCCCACCAGG - Intronic
1052429551 9:28348861-28348883 ACTGGGAGGCACCCCCCACCAGG + Intronic
1052881078 9:33601154-33601176 GGTGGGAGTCAGCCCCCGGCAGG + Intergenic
1052928747 9:34039188-34039210 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1052928767 9:34039229-34039251 AGTTGGGGGGCGCCTCCGCCTGG + Intronic
1052941928 9:34137665-34137687 GGTGGGGGTCACCCACCGCCAGG + Intergenic
1052942003 9:34137840-34137862 TGGGGGGGTCAGCCCCCGTCCGG + Intergenic
1053048159 9:34936975-34936997 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1053255894 9:36615480-36615502 GGGGGGGGTCAGCCCCCGCCAGG - Intronic
1053407622 9:37891234-37891256 GGTGGGGGGCAGCCCCCACCCGG + Intronic
1053489347 9:38487679-38487701 GGTGGTGGTCAGCCCCCGTCTGG + Intergenic
1054760242 9:68998415-68998437 AATGAGGGGCAACCCGCGCCTGG - Intronic
1055580470 9:77702798-77702820 GCTGGGGGGCAGTCCCCACCCGG - Intergenic
1055580489 9:77702840-77702862 GCTGGGGGGCAGTCCCCGCCCGG - Intergenic
1055580509 9:77702882-77702904 GATTGGGGGCAGCCCCCGCCCGG - Intergenic
1056379859 9:86047273-86047295 AGTGGGCGGCAGCAGCAGCCAGG + Intronic
1056564385 9:87759069-87759091 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1057630440 9:96715609-96715631 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1057669695 9:97076999-97077021 GGTGGTGGTCAGCCCCCGTCTGG + Intergenic
1057716160 9:97498066-97498088 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1057792271 9:98132166-98132188 GGTGGGGTGCAGCCCTCACCTGG + Exonic
1058018862 9:100067980-100068002 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1058425818 9:104874775-104874797 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1058425840 9:104874821-104874843 GGTGGGGGCCAGCCCCCGCCCGG + Intronic
1058425864 9:104874867-104874889 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1058799411 9:108530460-108530482 AGTAGGGGGCAGCGCTCGTCGGG - Intergenic
1059879816 9:118677957-118677979 GGTTGGGGGCAGCCCCCGCCCGG - Intergenic
1059879855 9:118678050-118678072 GGTGGGGGGCAGCCCACGCCCGG - Intergenic
1059879876 9:118678096-118678118 GGTGGGGGGCATCCCCCGCCCGG - Intergenic
1059879899 9:118678142-118678164 GGTGGGGGGCATCCCCCGCCCGG - Intergenic
1060041554 9:120305165-120305187 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1060080172 9:120636812-120636834 GGTGGGGGGGCGCCCCCGCCCGG + Intronic
1060220927 9:121763677-121763699 AGGGTGGGGCAGGGCCCGCCAGG + Intronic
1060283139 9:122227279-122227301 AGAGAGGGGCGGCGCCCGCCGGG + Intronic
1060334744 9:122711266-122711288 GGTGGAGGTCAGCCCCCGCCAGG + Intergenic
1060369613 9:123057142-123057164 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1061143119 9:128780383-128780405 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1061143141 9:128780430-128780452 GTGGGGGGTCAGCCCCCGCCAGG + Intergenic
1061370331 9:130194114-130194136 AGGGGCTGGCAGCCCCCTCCCGG - Intronic
1061610121 9:131740257-131740279 GGTGTGGGGCCGACCCCGCCTGG + Intergenic
1061831643 9:133300125-133300147 GGTGGGGGGAAGCCCCCACCCGG + Intergenic
1061831663 9:133300167-133300189 GGTGGGGGGCAGCCCCCACCTGG + Intergenic
1061977320 9:134075941-134075963 GGTGGGGGACAGCCCCCGTCCGG + Intergenic
1061983933 9:134118465-134118487 GGGGGGGGTCAGCCCCGGCCAGG - Intergenic
1062429175 9:136519388-136519410 AGTGGGTAGCAGCCCCGCCCCGG + Intronic
1062519257 9:136950871-136950893 CCTGGGTGGCAGCCCCAGCCTGG - Intronic
1062523969 9:136970849-136970871 AGTGGGGAGCAGGACCCTCCGGG + Intronic
1062579940 9:137225014-137225036 GGTGGGTGGCAGCCCAGGCCTGG - Exonic
1062688467 9:137828335-137828357 GGTGGGGGGCAGCACATGCCAGG + Intronic
1185584680 X:1235681-1235703 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1185584729 X:1235780-1235802 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1185584752 X:1235828-1235850 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1185584802 X:1235927-1235949 GGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1186786915 X:12963473-12963495 GGTGGGGGTCAGCCCCCACCAGG + Intergenic
1186854492 X:13612663-13612685 GGTGGGGGGCAGCCCCCTCCCGG - Intronic
1187212509 X:17244935-17244957 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1187976539 X:24709476-24709498 GGGGGGGGTCAGCCCCCGCCAGG - Intronic
1188086447 X:25906078-25906100 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1188086467 X:25906124-25906146 GGTGGGGGGCAGACCCCGCCCGG + Intergenic
1188367654 X:29333746-29333768 GGGGGGGGTCAGCCCCCACCCGG - Intronic
1188477174 X:30602499-30602521 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1188477274 X:30602723-30602745 TGGGGGGGTCAGCCTCCGCCCGG + Intergenic
1188942857 X:36261942-36261964 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1188942880 X:36261989-36262011 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1189056795 X:37707249-37707271 GTGGGGGGTCAGCCCCCGCCCGG - Intronic
1189056816 X:37707296-37707318 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1189210224 X:39277715-39277737 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1189570003 X:42285749-42285771 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1189825220 X:44911114-44911136 GGTGGGGGCCAGCCCCCGCCCGG - Intronic
1189825242 X:44911160-44911182 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1189838046 X:45041417-45041439 GGGGGGGGTCAGTCCCCGCCCGG - Intronic
1189968519 X:46396000-46396022 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1190159103 X:48017218-48017240 GGTGGGGGGCAGCCCCCACCAGG + Intronic
1190174756 X:48139320-48139342 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1190174775 X:48139362-48139384 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1190174795 X:48139404-48139426 AGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1190174814 X:48139446-48139468 GGTGGGGGGCAGCCCCCACCAGG + Intergenic
1190265876 X:48826963-48826985 AGTGGCGCGGAGCCCCCGGCGGG - Intergenic
1190505171 X:51119454-51119476 GGTGGGGGGCAGCCCCCACCTGG - Intergenic
1190505212 X:51119545-51119567 GGTGGGTTGCAGCCCCCGCCTGG - Intergenic
1190505229 X:51119587-51119609 GGAGGGAGGCAGCCCCCGCCCGG - Intergenic
1190779366 X:53579197-53579219 GGGGGGGGTCAGCCCCCGCCCGG + Intronic
1190793624 X:53721841-53721863 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1190793646 X:53721887-53721909 GGTGGGGGGCAGTCCCCGCCTGG + Intergenic
1190839132 X:54129150-54129172 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1190906851 X:54736658-54736680 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1190906872 X:54736700-54736722 GGTGGGGGGCAGCCCCCACCTGG + Intergenic
1190906889 X:54736741-54736763 AGGTGGGGGCAGCCCCCGCCTGG + Intergenic
1190906901 X:54736768-54736790 AGTGGGGGGCAGCCCCTGCCCGG + Intergenic
1191009912 X:55748735-55748757 GGTGGGGGTCAGCCCCCACCAGG + Intronic
1191010180 X:55749362-55749384 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1191068976 X:56380279-56380301 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1191618168 X:63189782-63189804 GGGGGTGGTCAGCCCCCGCCCGG - Intergenic
1191637394 X:63393304-63393326 GGTGGGGGTCAGCCCCCACCAGG + Intergenic
1191679318 X:63825452-63825474 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1191794069 X:65002349-65002371 GCAGGGGGTCAGCCCCCGCCCGG + Intronic
1191794092 X:65002396-65002418 GCGGGGGGTCAGCCCCCGCCCGG + Intronic
1191894181 X:65975325-65975347 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1191894202 X:65975371-65975393 GGTGGGGGGCAGACCCCGCCCGG - Intergenic
1192107140 X:68327029-68327051 TGGGGGGAACAGCCCCCGCCCGG + Intronic
1192211145 X:69128809-69128831 AGTGGCGGGCAGCCTGCCCCTGG - Intergenic
1192252162 X:69422218-69422240 GGTGGGGGACAGCCCCCGCCCGG + Intergenic
1192252183 X:69422264-69422286 GGTGGAGGGCAGCCCCCACCCGG + Intergenic
1192324850 X:70123263-70123285 AGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1192352840 X:70371691-70371713 TGGGGGGGTCAGGCCCCGCCCGG - Intronic
1192464061 X:71341696-71341718 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1192500070 X:71644988-71645010 GGTGGGGGGCAGACCCCGCCCGG - Intergenic
1192500091 X:71645030-71645052 GGTGGGGGGCAGCCCCCGCCCGG - Intergenic
1192500111 X:71645072-71645094 GGTGGGGGGCAGACCCCGCCCGG - Intergenic
1192500131 X:71645118-71645140 GGTGGGGGGCAGACCCCGCCCGG - Intergenic
1192530202 X:71876907-71876929 GGTGGGGAGCAGCCCCCGCCTGG - Intergenic
1192530222 X:71876953-71876975 GGTGGGGGGCAGCCCCCACCCGG - Intergenic
1192610298 X:72559941-72559963 GGTGGAGGGCAGCCCCCGCCCGG + Intronic
1192761331 X:74098592-74098614 GGTGGGGGGCAGTCCCCGCCCGG + Intergenic
1192761351 X:74098638-74098660 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1192794160 X:74412674-74412696 GTGGGGGGTCAGCCCCCGCCCGG - Intergenic
1192813439 X:74568751-74568773 GGTGGGGGTCAGCCCCCGCCAGG - Intergenic
1192892670 X:75407438-75407460 GGTGGGAGGCAGCCCCCGCCCGG + Intronic
1192892699 X:75407501-75407523 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1192892722 X:75407547-75407569 GGTGGGGGGCAGCCCCCGCCCGG + Intronic
1193132384 X:77932034-77932056 GGTGGGGGTCAGCCCCCGCCAGG - Intronic
1193328974 X:80215165-80215187 GGTGGGGGGCAGCCCCCACCCGG + Intergenic
1193328996 X:80215211-80215233 GGTGGGGGGCAGCCCCCGACTGG + Intergenic
1193924394 X:87466179-87466201 GGCGGGGGGCAGCCCCTGCCCGG + Intergenic
1194714570 X:97275260-97275282 TTGGGGGGGCAGCCCCTGCCCGG - Intronic
1194714594 X:97275308-97275330 GCGGGGGGACAGCCCCCGCCGGG - Intronic
1194714619 X:97275359-97275381 TGGGGGGGGCAGCCCCCGCCCGG - Intronic
1194714643 X:97275407-97275429 AAGGGGGGGCAGCCCCCGCCTGG - Intronic
1195009811 X:100723870-100723892 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1195009832 X:100723917-100723939 GTGGGGGGTCAGCCCCCGCCAGG + Intronic
1195257499 X:103104467-103104489 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
1195535329 X:106003191-106003213 AGTGTGGGGTAACCCCCTCCAGG + Intergenic
1195888978 X:109671408-109671430 GCTGGGGGGCAGCCCCCGCCTGG + Intronic
1196404458 X:115347675-115347697 GGGGGGGGTCAGCCCCCGCCAGG - Intergenic
1196778560 X:119362222-119362244 GATGGGGGTCAGCCCCAGCCAGG + Intergenic
1197185954 X:123587872-123587894 GGTGGGGGGCAGCCCCCGCCCGG + Intergenic
1197452970 X:126641584-126641606 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1197455718 X:126674122-126674144 GTGGGGGGGCAGCCCCCGCCCGG + Intergenic
1197455762 X:126674216-126674238 GTGGGGGGTCAGCCCCCGCCCGG + Intergenic
1197455784 X:126674263-126674285 GTGGGGGGTCAGCCCCCGCCTGG + Intergenic
1197502169 X:127255745-127255767 AGTGGGAGGCACCCCCCAGCAGG - Intergenic
1197735951 X:129850648-129850670 GGTGGGGGTCAGCCCCCGCCAGG + Intergenic
1197880064 X:131157548-131157570 ACTGGGAGGCACCCCCCACCAGG - Intergenic
1197972909 X:132133482-132133504 ACTGGGAGGCACCCCCCACCAGG + Intergenic
1198108614 X:133483824-133483846 GGTGGGGGGCAGCCCCCGTCCGG - Intergenic
1198243018 X:134802927-134802949 CCTGGGGAGCAGCCCCGGCCAGG + Intronic
1198246892 X:134839561-134839583 GGTGGGGGTCAGCCCCCGCCAGG + Intronic
1198600753 X:138282665-138282687 GGTGGAGGGCAGCCCCCGCCCGG - Intergenic
1198600772 X:138282711-138282733 GTGGGGGGGCAGCCCCCACCTGG - Intergenic
1199230992 X:145436454-145436476 GTGGGGGGTCAGCCCCCGCCAGG + Intergenic
1199836736 X:151599438-151599460 GGTGGCGGGCAGCCCCCGCCCGG - Intronic
1200324563 X:155223815-155223837 GGTGGGGGGCAGCCCCCGCCCGG - Intronic
1200952882 Y:8918100-8918122 GTTGGGGGTCAGCCCCTGCCCGG - Intergenic
1201282279 Y:12352301-12352323 GGTGGGGGGCAGCCTCCACCCGG + Intergenic
1201335823 Y:12878929-12878951 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1201948314 Y:19535837-19535859 GGTGGGGGGCAGCCCCCGCCAGG + Intergenic
1202327363 Y:23705327-23705349 ACTGGGGGGCACCCCCCAGCAGG + Intergenic
1202543407 Y:25964725-25964747 ACTGGGGGGCACCCCCCAGCAGG - Intergenic