ID: 1082166401

View in Genome Browser
Species Human (GRCh38)
Location 11:48955594-48955616
Sequence CGCCCCTTCCGGGAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166401_1082166413 -7 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166401_1082166419 26 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG No data
1082166401_1082166414 13 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166414 11:48955630-48955652 GGGTCTCCTCACTTCCCAGAAGG No data
1082166401_1082166415 14 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166415 11:48955631-48955653 GGTCTCCTCACTTCCCAGAAGGG No data
1082166401_1082166412 -8 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166412 11:48955609-48955631 AAGGGGCGGGTGCTGGGCAGAGG No data
1082166401_1082166418 25 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166418 11:48955642-48955664 TTCCCAGAAGGGGCAGCTGCCGG No data
1082166401_1082166416 15 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166401 Original CRISPR CGCCCCTTCCGGGAAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr