ID: 1082166410

View in Genome Browser
Species Human (GRCh38)
Location 11:48955604-48955626
Sequence GCCCAGCACCCGCCCCTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166410_1082166423 23 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166423 11:48955650-48955672 AGGGGCAGCTGCCGGGCGTAGGG No data
1082166410_1082166415 4 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166415 11:48955631-48955653 GGTCTCCTCACTTCCCAGAAGGG No data
1082166410_1082166422 22 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166422 11:48955649-48955671 AAGGGGCAGCTGCCGGGCGTAGG No data
1082166410_1082166424 24 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166424 11:48955651-48955673 GGGGCAGCTGCCGGGCGTAGGGG No data
1082166410_1082166414 3 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166414 11:48955630-48955652 GGGTCTCCTCACTTCCCAGAAGG No data
1082166410_1082166418 15 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166418 11:48955642-48955664 TTCCCAGAAGGGGCAGCTGCCGG No data
1082166410_1082166419 16 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG No data
1082166410_1082166416 5 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166410 Original CRISPR GCCCAGCACCCGCCCCTTCC GGG (reversed) Intergenic
No off target data available for this crispr