ID: 1082166413

View in Genome Browser
Species Human (GRCh38)
Location 11:48955610-48955632
Sequence AGGGGCGGGTGCTGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166387_1082166413 28 Left 1082166387 11:48955559-48955581 CCTCCCGGATGGGGTGGCTGGCC 0: 91
1: 1460
2: 6243
3: 4242
4: 2256
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166406_1082166413 -10 Left 1082166406 11:48955597-48955619 CCCACTTCCCGGAAGGGGCGGGT No data
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166404_1082166413 -9 Left 1082166404 11:48955596-48955618 CCCCACTTCCCGGAAGGGGCGGG No data
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166389_1082166413 25 Left 1082166389 11:48955562-48955584 CCCGGATGGGGTGGCTGGCCGGG 0: 77
1: 1297
2: 5816
3: 3948
4: 2547
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166402_1082166413 -8 Left 1082166402 11:48955595-48955617 CCCCCACTTCCCGGAAGGGGCGG No data
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166386_1082166413 29 Left 1082166386 11:48955558-48955580 CCCTCCCGGATGGGGTGGCTGGC 0: 59
1: 1094
2: 4937
3: 2573
4: 994
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166401_1082166413 -7 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166391_1082166413 24 Left 1082166391 11:48955563-48955585 CCGGATGGGGTGGCTGGCCGGGC 0: 79
1: 1274
2: 5638
3: 3393
4: 1672
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data
1082166396_1082166413 7 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166413 11:48955610-48955632 AGGGGCGGGTGCTGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166413 Original CRISPR AGGGGCGGGTGCTGGGCAGA GGG Intergenic
No off target data available for this crispr