ID: 1082166416

View in Genome Browser
Species Human (GRCh38)
Location 11:48955632-48955654
Sequence GTCTCCTCACTTCCCAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166401_1082166416 15 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data
1082166406_1082166416 12 Left 1082166406 11:48955597-48955619 CCCACTTCCCGGAAGGGGCGGGT No data
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data
1082166396_1082166416 29 Left 1082166396 11:48955580-48955602 CCGGGCGGGGGCTGCCCCCCACT 0: 6
1: 271
2: 425
3: 324
4: 617
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data
1082166410_1082166416 5 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data
1082166404_1082166416 13 Left 1082166404 11:48955596-48955618 CCCCACTTCCCGGAAGGGGCGGG No data
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data
1082166402_1082166416 14 Left 1082166402 11:48955595-48955617 CCCCCACTTCCCGGAAGGGGCGG No data
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data
1082166411_1082166416 4 Left 1082166411 11:48955605-48955627 CCGGAAGGGGCGGGTGCTGGGCA No data
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data
1082166407_1082166416 11 Left 1082166407 11:48955598-48955620 CCACTTCCCGGAAGGGGCGGGTG No data
Right 1082166416 11:48955632-48955654 GTCTCCTCACTTCCCAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166416 Original CRISPR GTCTCCTCACTTCCCAGAAG GGG Intergenic
No off target data available for this crispr