ID: 1082166417

View in Genome Browser
Species Human (GRCh38)
Location 11:48955636-48955658
Sequence GCTGCCCCTTCTGGGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22600
Summary {0: 28, 1: 589, 2: 5155, 3: 9045, 4: 7783}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166417_1082166422 -10 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166422 11:48955649-48955671 AAGGGGCAGCTGCCGGGCGTAGG No data
1082166417_1082166430 23 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166430 11:48955682-48955704 TTCTCAGATGGGGCAGCTGCCGG 0: 23
1: 321
2: 621
3: 872
4: 1449
1082166417_1082166427 12 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166427 11:48955671-48955693 GGGCTCCTCACTTCTCAGATGGG 0: 258
1: 1867
2: 2264
3: 6789
4: 6457
1082166417_1082166424 -8 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166424 11:48955651-48955673 GGGGCAGCTGCCGGGCGTAGGGG No data
1082166417_1082166428 13 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166428 11:48955672-48955694 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245
1082166417_1082166431 24 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1082166417_1082166433 30 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
1082166417_1082166432 27 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166432 11:48955686-48955708 CAGATGGGGCAGCTGCCGGGCGG 0: 21
1: 350
2: 942
3: 1240
4: 1782
1082166417_1082166423 -9 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166423 11:48955650-48955672 AGGGGCAGCTGCCGGGCGTAGGG No data
1082166417_1082166426 11 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166426 11:48955670-48955692 GGGGCTCCTCACTTCTCAGATGG 0: 1678
1: 2039
2: 4785
3: 5902
4: 5145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166417 Original CRISPR GCTGCCCCTTCTGGGAAGTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr