ID: 1082166417

View in Genome Browser
Species Human (GRCh38)
Location 11:48955636-48955658
Sequence GCTGCCCCTTCTGGGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166417_1082166426 11 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166426 11:48955670-48955692 GGGGCTCCTCACTTCTCAGATGG No data
1082166417_1082166433 30 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG No data
1082166417_1082166432 27 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166432 11:48955686-48955708 CAGATGGGGCAGCTGCCGGGCGG No data
1082166417_1082166430 23 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166430 11:48955682-48955704 TTCTCAGATGGGGCAGCTGCCGG No data
1082166417_1082166422 -10 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166422 11:48955649-48955671 AAGGGGCAGCTGCCGGGCGTAGG No data
1082166417_1082166423 -9 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166423 11:48955650-48955672 AGGGGCAGCTGCCGGGCGTAGGG No data
1082166417_1082166428 13 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166428 11:48955672-48955694 GGCTCCTCACTTCTCAGATGGGG No data
1082166417_1082166431 24 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG No data
1082166417_1082166427 12 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166427 11:48955671-48955693 GGGCTCCTCACTTCTCAGATGGG No data
1082166417_1082166424 -8 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166424 11:48955651-48955673 GGGGCAGCTGCCGGGCGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166417 Original CRISPR GCTGCCCCTTCTGGGAAGTG AGG (reversed) Intergenic