ID: 1082166419

View in Genome Browser
Species Human (GRCh38)
Location 11:48955643-48955665
Sequence TCCCAGAAGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166402_1082166419 25 Left 1082166402 11:48955595-48955617 CCCCCACTTCCCGGAAGGGGCGG No data
Right 1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG No data
1082166407_1082166419 22 Left 1082166407 11:48955598-48955620 CCACTTCCCGGAAGGGGCGGGTG No data
Right 1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG No data
1082166406_1082166419 23 Left 1082166406 11:48955597-48955619 CCCACTTCCCGGAAGGGGCGGGT No data
Right 1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG No data
1082166410_1082166419 16 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG No data
1082166401_1082166419 26 Left 1082166401 11:48955594-48955616 CCCCCCACTTCCCGGAAGGGGCG No data
Right 1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG No data
1082166411_1082166419 15 Left 1082166411 11:48955605-48955627 CCGGAAGGGGCGGGTGCTGGGCA No data
Right 1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG No data
1082166404_1082166419 24 Left 1082166404 11:48955596-48955618 CCCCACTTCCCGGAAGGGGCGGG No data
Right 1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166419 Original CRISPR TCCCAGAAGGGGCAGCTGCC GGG Intergenic
No off target data available for this crispr