ID: 1082166421

View in Genome Browser
Species Human (GRCh38)
Location 11:48955645-48955667
Sequence CGCCCGGCAGCTGCCCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166421_1082166427 3 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166427 11:48955671-48955693 GGGCTCCTCACTTCTCAGATGGG No data
1082166421_1082166434 22 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166434 11:48955690-48955712 TGGGGCAGCTGCCGGGCGGAGGG No data
1082166421_1082166432 18 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166432 11:48955686-48955708 CAGATGGGGCAGCTGCCGGGCGG No data
1082166421_1082166431 15 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG No data
1082166421_1082166435 23 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166435 11:48955691-48955713 GGGGCAGCTGCCGGGCGGAGGGG No data
1082166421_1082166433 21 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG No data
1082166421_1082166426 2 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166426 11:48955670-48955692 GGGGCTCCTCACTTCTCAGATGG No data
1082166421_1082166430 14 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166430 11:48955682-48955704 TTCTCAGATGGGGCAGCTGCCGG No data
1082166421_1082166428 4 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166428 11:48955672-48955694 GGCTCCTCACTTCTCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166421 Original CRISPR CGCCCGGCAGCTGCCCCTTC TGG (reversed) Intergenic