ID: 1082166423

View in Genome Browser
Species Human (GRCh38)
Location 11:48955650-48955672
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166410_1082166423 23 Left 1082166410 11:48955604-48955626 CCCGGAAGGGGCGGGTGCTGGGC No data
Right 1082166423 11:48955650-48955672 AGGGGCAGCTGCCGGGCGTAGGG No data
1082166407_1082166423 29 Left 1082166407 11:48955598-48955620 CCACTTCCCGGAAGGGGCGGGTG No data
Right 1082166423 11:48955650-48955672 AGGGGCAGCTGCCGGGCGTAGGG No data
1082166417_1082166423 -9 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166423 11:48955650-48955672 AGGGGCAGCTGCCGGGCGTAGGG No data
1082166411_1082166423 22 Left 1082166411 11:48955605-48955627 CCGGAAGGGGCGGGTGCTGGGCA No data
Right 1082166423 11:48955650-48955672 AGGGGCAGCTGCCGGGCGTAGGG No data
1082166406_1082166423 30 Left 1082166406 11:48955597-48955619 CCCACTTCCCGGAAGGGGCGGGT No data
Right 1082166423 11:48955650-48955672 AGGGGCAGCTGCCGGGCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166423 Original CRISPR AGGGGCAGCTGCCGGGCGTA GGG Intergenic
No off target data available for this crispr