ID: 1082166425

View in Genome Browser
Species Human (GRCh38)
Location 11:48955661-48955683
Sequence AAGTGAGGAGCCCCTACGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18842
Summary {0: 11, 1: 1306, 2: 4831, 3: 5160, 4: 7534}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166425_1082166438 28 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166438 11:48955712-48955734 GGCTCCTCACTTCCCAGACTGGG No data
1082166425_1082166434 6 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166434 11:48955690-48955712 TGGGGCAGCTGCCGGGCGGAGGG 0: 18
1: 327
2: 706
3: 933
4: 1140
1082166425_1082166430 -2 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166430 11:48955682-48955704 TTCTCAGATGGGGCAGCTGCCGG 0: 23
1: 321
2: 621
3: 872
4: 1449
1082166425_1082166432 2 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166432 11:48955686-48955708 CAGATGGGGCAGCTGCCGGGCGG 0: 21
1: 350
2: 942
3: 1240
4: 1782
1082166425_1082166435 7 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166435 11:48955691-48955713 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
1082166425_1082166433 5 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
1082166425_1082166437 27 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166437 11:48955711-48955733 GGGCTCCTCACTTCCCAGACTGG 0: 286
1: 2796
2: 9084
3: 7841
4: 5698
1082166425_1082166431 -1 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166425 Original CRISPR AAGTGAGGAGCCCCTACGCC CGG (reversed) Intergenic
Too many off-targets to display for this crispr