ID: 1082166425

View in Genome Browser
Species Human (GRCh38)
Location 11:48955661-48955683
Sequence AAGTGAGGAGCCCCTACGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166425_1082166432 2 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT No data
Right 1082166432 11:48955686-48955708 CAGATGGGGCAGCTGCCGGGCGG No data
1082166425_1082166431 -1 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT No data
Right 1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG No data
1082166425_1082166438 28 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT No data
Right 1082166438 11:48955712-48955734 GGCTCCTCACTTCCCAGACTGGG No data
1082166425_1082166434 6 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT No data
Right 1082166434 11:48955690-48955712 TGGGGCAGCTGCCGGGCGGAGGG No data
1082166425_1082166430 -2 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT No data
Right 1082166430 11:48955682-48955704 TTCTCAGATGGGGCAGCTGCCGG No data
1082166425_1082166437 27 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT No data
Right 1082166437 11:48955711-48955733 GGGCTCCTCACTTCCCAGACTGG No data
1082166425_1082166435 7 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT No data
Right 1082166435 11:48955691-48955713 GGGGCAGCTGCCGGGCGGAGGGG No data
1082166425_1082166433 5 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166425 Original CRISPR AAGTGAGGAGCCCCTACGCC CGG (reversed) Intergenic