ID: 1082166426

View in Genome Browser
Species Human (GRCh38)
Location 11:48955670-48955692
Sequence GGGGCTCCTCACTTCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166420_1082166426 3 Left 1082166420 11:48955644-48955666 CCCAGAAGGGGCAGCTGCCGGGC No data
Right 1082166426 11:48955670-48955692 GGGGCTCCTCACTTCTCAGATGG No data
1082166421_1082166426 2 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166426 11:48955670-48955692 GGGGCTCCTCACTTCTCAGATGG No data
1082166417_1082166426 11 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166426 11:48955670-48955692 GGGGCTCCTCACTTCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166426 Original CRISPR GGGGCTCCTCACTTCTCAGA TGG Intergenic