ID: 1082166427

View in Genome Browser
Species Human (GRCh38)
Location 11:48955671-48955693
Sequence GGGCTCCTCACTTCTCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17635
Summary {0: 258, 1: 1867, 2: 2264, 3: 6789, 4: 6457}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166417_1082166427 12 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166427 11:48955671-48955693 GGGCTCCTCACTTCTCAGATGGG 0: 258
1: 1867
2: 2264
3: 6789
4: 6457
1082166421_1082166427 3 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166427 11:48955671-48955693 GGGCTCCTCACTTCTCAGATGGG 0: 258
1: 1867
2: 2264
3: 6789
4: 6457
1082166420_1082166427 4 Left 1082166420 11:48955644-48955666 CCCAGAAGGGGCAGCTGCCGGGC No data
Right 1082166427 11:48955671-48955693 GGGCTCCTCACTTCTCAGATGGG 0: 258
1: 1867
2: 2264
3: 6789
4: 6457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166427 Original CRISPR GGGCTCCTCACTTCTCAGAT GGG Intergenic
Too many off-targets to display for this crispr