ID: 1082166428

View in Genome Browser
Species Human (GRCh38)
Location 11:48955672-48955694
Sequence GGCTCCTCACTTCTCAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17195
Summary {0: 274, 1: 1958, 2: 2549, 3: 7169, 4: 5245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166420_1082166428 5 Left 1082166420 11:48955644-48955666 CCCAGAAGGGGCAGCTGCCGGGC No data
Right 1082166428 11:48955672-48955694 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245
1082166417_1082166428 13 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166428 11:48955672-48955694 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245
1082166421_1082166428 4 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166428 11:48955672-48955694 GGCTCCTCACTTCTCAGATGGGG 0: 274
1: 1958
2: 2549
3: 7169
4: 5245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166428 Original CRISPR GGCTCCTCACTTCTCAGATG GGG Intergenic
Too many off-targets to display for this crispr