ID: 1082166429

View in Genome Browser
Species Human (GRCh38)
Location 11:48955676-48955698
Sequence GCTGCCCCATCTGAGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17486
Summary {0: 40, 1: 635, 2: 2227, 3: 3801, 4: 10783}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166429_1082166442 24 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166442 11:48955723-48955745 TCCCAGACTGGGTGGCTGCCGGG No data
1082166429_1082166446 30 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166446 11:48955729-48955751 ACTGGGTGGCTGCCGGGTGGAGG No data
1082166429_1082166445 27 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166445 11:48955726-48955748 CAGACTGGGTGGCTGCCGGGTGG No data
1082166429_1082166434 -9 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166434 11:48955690-48955712 TGGGGCAGCTGCCGGGCGGAGGG 0: 18
1: 327
2: 706
3: 933
4: 1140
1082166429_1082166435 -8 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166435 11:48955691-48955713 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
1082166429_1082166439 16 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166439 11:48955715-48955737 TCCTCACTTCCCAGACTGGGTGG 0: 263
1: 2849
2: 5811
3: 7001
4: 5678
1082166429_1082166441 23 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166441 11:48955722-48955744 TTCCCAGACTGGGTGGCTGCCGG 0: 14
1: 598
2: 2093
3: 2916
4: 3962
1082166429_1082166437 12 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166437 11:48955711-48955733 GGGCTCCTCACTTCCCAGACTGG 0: 286
1: 2796
2: 9084
3: 7841
4: 5698
1082166429_1082166438 13 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166438 11:48955712-48955734 GGCTCCTCACTTCCCAGACTGGG No data
1082166429_1082166433 -10 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166429 Original CRISPR GCTGCCCCATCTGAGAAGTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr