ID: 1082166432

View in Genome Browser
Species Human (GRCh38)
Location 11:48955686-48955708
Sequence CAGATGGGGCAGCTGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4335
Summary {0: 21, 1: 350, 2: 942, 3: 1240, 4: 1782}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166417_1082166432 27 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166432 11:48955686-48955708 CAGATGGGGCAGCTGCCGGGCGG 0: 21
1: 350
2: 942
3: 1240
4: 1782
1082166420_1082166432 19 Left 1082166420 11:48955644-48955666 CCCAGAAGGGGCAGCTGCCGGGC No data
Right 1082166432 11:48955686-48955708 CAGATGGGGCAGCTGCCGGGCGG 0: 21
1: 350
2: 942
3: 1240
4: 1782
1082166421_1082166432 18 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166432 11:48955686-48955708 CAGATGGGGCAGCTGCCGGGCGG 0: 21
1: 350
2: 942
3: 1240
4: 1782
1082166425_1082166432 2 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166432 11:48955686-48955708 CAGATGGGGCAGCTGCCGGGCGG 0: 21
1: 350
2: 942
3: 1240
4: 1782

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166432 Original CRISPR CAGATGGGGCAGCTGCCGGG CGG Intergenic
Too many off-targets to display for this crispr