ID: 1082166433

View in Genome Browser
Species Human (GRCh38)
Location 11:48955689-48955711
Sequence ATGGGGCAGCTGCCGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3897
Summary {0: 19, 1: 345, 2: 772, 3: 1086, 4: 1675}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166429_1082166433 -10 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
1082166425_1082166433 5 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
1082166420_1082166433 22 Left 1082166420 11:48955644-48955666 CCCAGAAGGGGCAGCTGCCGGGC No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
1082166421_1082166433 21 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675
1082166417_1082166433 30 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC 0: 28
1: 589
2: 5155
3: 9045
4: 7783
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG 0: 19
1: 345
2: 772
3: 1086
4: 1675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166433 Original CRISPR ATGGGGCAGCTGCCGGGCGG AGG Intergenic
Too many off-targets to display for this crispr