ID: 1082166433

View in Genome Browser
Species Human (GRCh38)
Location 11:48955689-48955711
Sequence ATGGGGCAGCTGCCGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166429_1082166433 -10 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG No data
1082166420_1082166433 22 Left 1082166420 11:48955644-48955666 CCCAGAAGGGGCAGCTGCCGGGC No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG No data
1082166425_1082166433 5 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG No data
1082166417_1082166433 30 Left 1082166417 11:48955636-48955658 CCTCACTTCCCAGAAGGGGCAGC No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG No data
1082166421_1082166433 21 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166433 11:48955689-48955711 ATGGGGCAGCTGCCGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166433 Original CRISPR ATGGGGCAGCTGCCGGGCGG AGG Intergenic