ID: 1082166435

View in Genome Browser
Species Human (GRCh38)
Location 11:48955691-48955713
Sequence GGGGCAGCTGCCGGGCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3729
Summary {0: 207, 1: 595, 2: 988, 3: 788, 4: 1151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166420_1082166435 24 Left 1082166420 11:48955644-48955666 CCCAGAAGGGGCAGCTGCCGGGC No data
Right 1082166435 11:48955691-48955713 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
1082166425_1082166435 7 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166435 11:48955691-48955713 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
1082166429_1082166435 -8 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166435 11:48955691-48955713 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151
1082166421_1082166435 23 Left 1082166421 11:48955645-48955667 CCAGAAGGGGCAGCTGCCGGGCG No data
Right 1082166435 11:48955691-48955713 GGGGCAGCTGCCGGGCGGAGGGG 0: 207
1: 595
2: 988
3: 788
4: 1151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166435 Original CRISPR GGGGCAGCTGCCGGGCGGAG GGG Intergenic
Too many off-targets to display for this crispr