ID: 1082166437

View in Genome Browser
Species Human (GRCh38)
Location 11:48955711-48955733
Sequence GGGCTCCTCACTTCCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25705
Summary {0: 286, 1: 2796, 2: 9084, 3: 7841, 4: 5698}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166429_1082166437 12 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166437 11:48955711-48955733 GGGCTCCTCACTTCCCAGACTGG 0: 286
1: 2796
2: 9084
3: 7841
4: 5698
1082166425_1082166437 27 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166437 11:48955711-48955733 GGGCTCCTCACTTCCCAGACTGG 0: 286
1: 2796
2: 9084
3: 7841
4: 5698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166437 Original CRISPR GGGCTCCTCACTTCCCAGAC TGG Intergenic
Too many off-targets to display for this crispr