ID: 1082166438

View in Genome Browser
Species Human (GRCh38)
Location 11:48955712-48955734
Sequence GGCTCCTCACTTCCCAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166425_1082166438 28 Left 1082166425 11:48955661-48955683 CCGGGCGTAGGGGCTCCTCACTT 0: 11
1: 1306
2: 4831
3: 5160
4: 7534
Right 1082166438 11:48955712-48955734 GGCTCCTCACTTCCCAGACTGGG No data
1082166429_1082166438 13 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166438 11:48955712-48955734 GGCTCCTCACTTCCCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166438 Original CRISPR GGCTCCTCACTTCCCAGACT GGG Intergenic
No off target data available for this crispr