ID: 1082166439

View in Genome Browser
Species Human (GRCh38)
Location 11:48955715-48955737
Sequence TCCTCACTTCCCAGACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21602
Summary {0: 263, 1: 2849, 2: 5811, 3: 7001, 4: 5678}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166436_1082166439 -9 Left 1082166436 11:48955701-48955723 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1082166439 11:48955715-48955737 TCCTCACTTCCCAGACTGGGTGG 0: 263
1: 2849
2: 5811
3: 7001
4: 5678
1082166429_1082166439 16 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166439 11:48955715-48955737 TCCTCACTTCCCAGACTGGGTGG 0: 263
1: 2849
2: 5811
3: 7001
4: 5678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166439 Original CRISPR TCCTCACTTCCCAGACTGGG TGG Intergenic
Too many off-targets to display for this crispr