ID: 1082166441

View in Genome Browser
Species Human (GRCh38)
Location 11:48955722-48955744
Sequence TTCCCAGACTGGGTGGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9583
Summary {0: 14, 1: 598, 2: 2093, 3: 2916, 4: 3962}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166429_1082166441 23 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166441 11:48955722-48955744 TTCCCAGACTGGGTGGCTGCCGG 0: 14
1: 598
2: 2093
3: 2916
4: 3962
1082166436_1082166441 -2 Left 1082166436 11:48955701-48955723 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1082166441 11:48955722-48955744 TTCCCAGACTGGGTGGCTGCCGG 0: 14
1: 598
2: 2093
3: 2916
4: 3962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166441 Original CRISPR TTCCCAGACTGGGTGGCTGC CGG Intergenic
Too many off-targets to display for this crispr