ID: 1082166445

View in Genome Browser
Species Human (GRCh38)
Location 11:48955726-48955748
Sequence CAGACTGGGTGGCTGCCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082166429_1082166445 27 Left 1082166429 11:48955676-48955698 CCTCACTTCTCAGATGGGGCAGC 0: 40
1: 635
2: 2227
3: 3801
4: 10783
Right 1082166445 11:48955726-48955748 CAGACTGGGTGGCTGCCGGGTGG No data
1082166436_1082166445 2 Left 1082166436 11:48955701-48955723 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1082166445 11:48955726-48955748 CAGACTGGGTGGCTGCCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082166445 Original CRISPR CAGACTGGGTGGCTGCCGGG TGG Intergenic
No off target data available for this crispr