ID: 1082170722

View in Genome Browser
Species Human (GRCh38)
Location 11:49001818-49001840
Sequence ATTTTTAAGGGGATTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082170722_1082170730 5 Left 1082170722 11:49001818-49001840 CCTTCCACAATCCCCTTAAAAAT No data
Right 1082170730 11:49001846-49001868 CCCAGAACTCCTTGGAAAGATGG No data
1082170722_1082170727 -3 Left 1082170722 11:49001818-49001840 CCTTCCACAATCCCCTTAAAAAT No data
Right 1082170727 11:49001838-49001860 AATTCCAGCCCAGAACTCCTTGG No data
1082170722_1082170732 13 Left 1082170722 11:49001818-49001840 CCTTCCACAATCCCCTTAAAAAT No data
Right 1082170732 11:49001854-49001876 TCCTTGGAAAGATGGATTTTAGG No data
1082170722_1082170734 14 Left 1082170722 11:49001818-49001840 CCTTCCACAATCCCCTTAAAAAT No data
Right 1082170734 11:49001855-49001877 CCTTGGAAAGATGGATTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082170722 Original CRISPR ATTTTTAAGGGGATTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr