ID: 1082171650

View in Genome Browser
Species Human (GRCh38)
Location 11:49012335-49012357
Sequence AAGAGGGGAATGGCTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082171650_1082171657 11 Left 1082171650 11:49012335-49012357 CCTGAGGCAGCCATTCCCCTCTT No data
Right 1082171657 11:49012369-49012391 ACAACAGCGGAATGCAGAGATGG No data
1082171650_1082171659 18 Left 1082171650 11:49012335-49012357 CCTGAGGCAGCCATTCCCCTCTT No data
Right 1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG No data
1082171650_1082171658 17 Left 1082171650 11:49012335-49012357 CCTGAGGCAGCCATTCCCCTCTT No data
Right 1082171658 11:49012375-49012397 GCGGAATGCAGAGATGGAGCAGG No data
1082171650_1082171660 23 Left 1082171650 11:49012335-49012357 CCTGAGGCAGCCATTCCCCTCTT No data
Right 1082171660 11:49012381-49012403 TGCAGAGATGGAGCAGGGCCTGG No data
1082171650_1082171655 -2 Left 1082171650 11:49012335-49012357 CCTGAGGCAGCCATTCCCCTCTT No data
Right 1082171655 11:49012356-49012378 TTAGATTCTGCCTACAACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082171650 Original CRISPR AAGAGGGGAATGGCTGCCTC AGG (reversed) Intergenic
No off target data available for this crispr