ID: 1082171654

View in Genome Browser
Species Human (GRCh38)
Location 11:49012352-49012374
Sequence TGTTGTAGGCAGAATCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082171654_1082171661 22 Left 1082171654 11:49012352-49012374 CCTCTTAGATTCTGCCTACAACA No data
Right 1082171661 11:49012397-49012419 GGCCTGGCTATTGATATCCCTGG No data
1082171654_1082171662 23 Left 1082171654 11:49012352-49012374 CCTCTTAGATTCTGCCTACAACA No data
Right 1082171662 11:49012398-49012420 GCCTGGCTATTGATATCCCTGGG No data
1082171654_1082171657 -6 Left 1082171654 11:49012352-49012374 CCTCTTAGATTCTGCCTACAACA No data
Right 1082171657 11:49012369-49012391 ACAACAGCGGAATGCAGAGATGG No data
1082171654_1082171658 0 Left 1082171654 11:49012352-49012374 CCTCTTAGATTCTGCCTACAACA No data
Right 1082171658 11:49012375-49012397 GCGGAATGCAGAGATGGAGCAGG No data
1082171654_1082171659 1 Left 1082171654 11:49012352-49012374 CCTCTTAGATTCTGCCTACAACA No data
Right 1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG No data
1082171654_1082171660 6 Left 1082171654 11:49012352-49012374 CCTCTTAGATTCTGCCTACAACA No data
Right 1082171660 11:49012381-49012403 TGCAGAGATGGAGCAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082171654 Original CRISPR TGTTGTAGGCAGAATCTAAG AGG (reversed) Intergenic
No off target data available for this crispr