ID: 1082171659

View in Genome Browser
Species Human (GRCh38)
Location 11:49012376-49012398
Sequence CGGAATGCAGAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082171650_1082171659 18 Left 1082171650 11:49012335-49012357 CCTGAGGCAGCCATTCCCCTCTT No data
Right 1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG No data
1082171651_1082171659 8 Left 1082171651 11:49012345-49012367 CCATTCCCCTCTTAGATTCTGCC No data
Right 1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG No data
1082171653_1082171659 2 Left 1082171653 11:49012351-49012373 CCCTCTTAGATTCTGCCTACAAC No data
Right 1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG No data
1082171652_1082171659 3 Left 1082171652 11:49012350-49012372 CCCCTCTTAGATTCTGCCTACAA No data
Right 1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG No data
1082171654_1082171659 1 Left 1082171654 11:49012352-49012374 CCTCTTAGATTCTGCCTACAACA No data
Right 1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082171659 Original CRISPR CGGAATGCAGAGATGGAGCA GGG Intergenic
No off target data available for this crispr