ID: 1082172272

View in Genome Browser
Species Human (GRCh38)
Location 11:49019776-49019798
Sequence CTATGCTGCCTGGGGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082172272_1082172279 17 Left 1082172272 11:49019776-49019798 CCAGGTTTCCCCAGGCAGCATAG No data
Right 1082172279 11:49019816-49019838 AAAACAAAATGTTTTTACCCAGG No data
1082172272_1082172280 22 Left 1082172272 11:49019776-49019798 CCAGGTTTCCCCAGGCAGCATAG No data
Right 1082172280 11:49019821-49019843 AAAATGTTTTTACCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082172272 Original CRISPR CTATGCTGCCTGGGGAAACC TGG (reversed) Intergenic
No off target data available for this crispr