ID: 1082172280

View in Genome Browser
Species Human (GRCh38)
Location 11:49019821-49019843
Sequence AAAATGTTTTTACCCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082172278_1082172280 -8 Left 1082172278 11:49019806-49019828 CCTGTCTCTAAAAACAAAATGTT No data
Right 1082172280 11:49019821-49019843 AAAATGTTTTTACCCAGGCCTGG No data
1082172276_1082172280 13 Left 1082172276 11:49019785-49019807 CCCAGGCAGCATAGGGTGACACC No data
Right 1082172280 11:49019821-49019843 AAAATGTTTTTACCCAGGCCTGG No data
1082172275_1082172280 14 Left 1082172275 11:49019784-49019806 CCCCAGGCAGCATAGGGTGACAC No data
Right 1082172280 11:49019821-49019843 AAAATGTTTTTACCCAGGCCTGG No data
1082172277_1082172280 12 Left 1082172277 11:49019786-49019808 CCAGGCAGCATAGGGTGACACCT No data
Right 1082172280 11:49019821-49019843 AAAATGTTTTTACCCAGGCCTGG No data
1082172272_1082172280 22 Left 1082172272 11:49019776-49019798 CCAGGTTTCCCCAGGCAGCATAG No data
Right 1082172280 11:49019821-49019843 AAAATGTTTTTACCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082172280 Original CRISPR AAAATGTTTTTACCCAGGCC TGG Intergenic
No off target data available for this crispr