ID: 1082175612

View in Genome Browser
Species Human (GRCh38)
Location 11:49055600-49055622
Sequence ATAACATATCTGGAGAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082175612 Original CRISPR ATAACATATCTGGAGAAATT GGG (reversed) Intronic
901958445 1:12806073-12806095 AACACATATCTGGACACATTTGG + Intergenic
903272609 1:22200274-22200296 ATAAAATAACTGGAGTACTTAGG - Intergenic
904095915 1:27977192-27977214 ATAACATATGTGAAAAAATAAGG + Intronic
906106532 1:43297095-43297117 ATAAAAAAGCTGGTGAAATTCGG - Intergenic
907068155 1:51507260-51507282 ATAAAATATCTGTACACATTAGG + Intronic
907796078 1:57719083-57719105 AAAACATATGTTGAGAAATTAGG + Intronic
909127837 1:71697105-71697127 TTAACATTTCTGGATATATTTGG + Intronic
909643357 1:77890183-77890205 ATAAAATATCTGCAAAAATACGG - Intronic
910121545 1:83796113-83796135 AGAACATTTCTGGACAAAATAGG + Intergenic
910308400 1:85794138-85794160 ATAAAATATCTGGAGATAAGAGG - Intronic
911452368 1:98079865-98079887 ATGCAAAATCTGGAGAAATTTGG + Intergenic
912004977 1:104887023-104887045 ATAACAAAGCTGGAAATATTGGG - Intergenic
915188634 1:154129294-154129316 ACAACATATATGGTGCAATTTGG + Exonic
915821821 1:159031842-159031864 ATAAAATATTTGAAGAAATTAGG + Intronic
916859491 1:168787639-168787661 ATAAAACATATGGAGAAATAGGG - Intergenic
917027962 1:170662810-170662832 ATAACAGCTGTGGGGAAATTTGG - Intronic
917203510 1:172543402-172543424 ATAATATATTTTCAGAAATTGGG - Intronic
917556796 1:176098731-176098753 ATAACTTACCTGGAATAATTTGG + Intronic
917634784 1:176924699-176924721 TTTACATATCTGGAGTAGTTGGG + Intronic
917877771 1:179302136-179302158 ATAACAAATCTGAAGAAATCAGG - Intronic
918988944 1:191672313-191672335 TTAACATTTTTGGAGAAATATGG - Intergenic
919542661 1:198870629-198870651 ATCACAAATTTGGAAAAATTTGG + Intergenic
923396000 1:233564598-233564620 ATAAAATATCTTAACAAATTAGG + Intergenic
923955761 1:239018246-239018268 ATAAAAGATCTTGTGAAATTTGG + Intergenic
1063496710 10:6516185-6516207 GTAACATACCTGGAGATCTTGGG + Intronic
1063852272 10:10206660-10206682 ATAACTTCTTTGGAGAATTTAGG + Intergenic
1064426110 10:15231088-15231110 ATTACAAATCTGGAGACATGTGG + Intronic
1064805774 10:19129910-19129932 ATCACATATCTGTAGATATGTGG + Intronic
1065351785 10:24802362-24802384 ATAACATGTCTGGATATATAAGG + Intergenic
1066553507 10:36585587-36585609 TTAACATATTTGAAGAAATTAGG + Intergenic
1067910999 10:50346870-50346892 TTAAAATATCTGTAGAGATTGGG + Intronic
1068769727 10:60807418-60807440 ATAAGATATGGGGAGGAATTTGG + Intergenic
1069289501 10:66760242-66760264 GTAACATATCTGGAGAACTGTGG - Intronic
1069642785 10:69966762-69966784 TTAAAATTTCTGGTGAAATTAGG + Intergenic
1070089728 10:73272409-73272431 ATAATATGCCTGAAGAAATTAGG + Intronic
1071056893 10:81521532-81521554 AAAACATATCTGGACAAATGGGG + Intergenic
1071487944 10:86115093-86115115 GTAACATACCTGGAGAGTTTGGG + Intronic
1071688496 10:87789310-87789332 ATAAGCTATCTCGTGAAATTTGG + Intronic
1071744536 10:88401326-88401348 ATAACATATATGTTGAAATTCGG + Intronic
1071925458 10:90403087-90403109 ATAAGATATCTAGAGAAAATGGG - Intergenic
1074609241 10:115005039-115005061 ATAACATTTGTAGAGAAATCTGG + Intergenic
1075435675 10:122439223-122439245 ATAACATATCTTGACCAAATGGG - Exonic
1077834415 11:5912224-5912246 AAAACAGTTCTGGAGAAACTTGG - Intronic
1078503550 11:11909985-11910007 CTTACATATTTGGACAAATTTGG - Intronic
1079608485 11:22400372-22400394 ATAGCATATTTGGAGGACTTTGG + Intergenic
1080530222 11:33167573-33167595 ATAAAATAACTGGAGATAATCGG + Intergenic
1081823733 11:46025683-46025705 ATAACATTTTTGGGGAATTTGGG - Intronic
1082169842 11:48990570-48990592 ATAACATATGATGAGAAAATTGG - Intergenic
1082175612 11:49055600-49055622 ATAACATATCTGGAGAAATTGGG - Intronic
1082643714 11:55695366-55695388 ATATCAAATGTGGACAAATTTGG + Intergenic
1086690137 11:89780469-89780491 ATAACATATCTGGGGAAACTGGG + Intergenic
1086698525 11:89872503-89872525 ATAACGTATCTGGGGAAATTGGG - Intronic
1086715717 11:90059488-90059510 ATAACATATCTGGGGAAACTGGG - Intergenic
1086797900 11:91131901-91131923 AGAAAATATCTCGAGAAAGTGGG - Intergenic
1087151531 11:94864568-94864590 ATAACTGAGCTGGGGAAATTGGG + Intronic
1089231312 11:116979478-116979500 ATAACATATATGCAAAAATGTGG + Intronic
1089335818 11:117723300-117723322 AGAACATATCTGGAAATATGGGG - Intronic
1089345949 11:117791925-117791947 ATTTCATAGCTGGAGAAAGTGGG + Intronic
1090152033 11:124394818-124394840 ATTATATATCTGAACAAATTTGG - Intergenic
1090505969 11:127314553-127314575 ATAACCACTCTGGAAAAATTTGG - Intergenic
1090790415 11:130088791-130088813 ATAATATACCTGTAGAAAATAGG + Intronic
1091338149 11:134788705-134788727 CTAACATTTTTGGAAAAATTGGG + Intergenic
1092658095 12:10708992-10709014 CTTACATATATGGAGAGATTGGG - Intronic
1093075492 12:14753861-14753883 ATGAAATGTCAGGAGAAATTGGG + Intergenic
1093609954 12:21142863-21142885 ATAGCATATCTGGAGAAGCTGGG + Intronic
1094759868 12:33520117-33520139 ATAAAATATCTGAACAAATAGGG - Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1097569148 12:61309361-61309383 ATAAGAAATCAGGAAAAATTTGG - Intergenic
1098044653 12:66387713-66387735 ATAAGAACTCTAGAGAAATTGGG + Intronic
1098375845 12:69813180-69813202 ATAAAATTTGTGGAGAATTTGGG + Intronic
1100232656 12:92624661-92624683 AGAACTTATCTTGAGGAATTAGG - Intergenic
1104208673 12:126665699-126665721 AGAACAGATATGGATAAATTTGG - Intergenic
1105513938 13:21074703-21074725 ACAACTTAGCTGGAGAAATCTGG + Intergenic
1107369254 13:39724854-39724876 ATGACAGATATGAAGAAATTAGG + Intronic
1107608687 13:42090045-42090067 ATAATATATTTGGAAAAGTTGGG + Intronic
1108769969 13:53687705-53687727 ACAAGAAATTTGGAGAAATTTGG + Intergenic
1109920342 13:69049777-69049799 AAAACATATTTGAGGAAATTAGG + Intergenic
1110023265 13:70503015-70503037 ACACCATATCTGCAAAAATTCGG + Intergenic
1110091924 13:71461735-71461757 ATAACTTCTCTGGAGAAATTTGG + Intronic
1110094278 13:71496843-71496865 ATAAAATATCTAGAGGTATTTGG + Intronic
1110578072 13:77083577-77083599 ATAACATATGTTTAGAAGTTGGG + Intronic
1110764294 13:79265341-79265363 ATAAGCTTTCTTGAGAAATTGGG - Intergenic
1111095413 13:83507599-83507621 ATGACATATCTGGGTAGATTGGG + Intergenic
1112660472 13:101501907-101501929 ATCACAAAGATGGAGAAATTGGG + Intronic
1114476326 14:22997713-22997735 ATAACATATAGGGAGAAAGAGGG - Intronic
1114510957 14:23260414-23260436 CTAACATATGTGGGGAAATACGG - Intronic
1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG + Intergenic
1114932565 14:27492249-27492271 ATAACATTTCTCAACAAATTAGG + Intergenic
1115050593 14:29057010-29057032 ATAAGGTATCTAGAGAAGTTTGG + Intergenic
1115850518 14:37586280-37586302 CTAACATAATTGGAGAAATAAGG + Intergenic
1116202978 14:41823470-41823492 CTTACAAATCTGAAGAAATTAGG - Intronic
1116450257 14:45056714-45056736 ATAAAATATCAGGATCAATTGGG - Intronic
1117419150 14:55526583-55526605 GAAACATAACTTGAGAAATTTGG - Intergenic
1117831778 14:59758552-59758574 ATAACATCTCTGGTGAAGTCTGG + Intronic
1118138710 14:63056222-63056244 ATACCATCTTTGGAGAAATCAGG + Intronic
1118410621 14:65473981-65474003 ATAACATTTTTGCAGCAATTTGG + Intronic
1119874290 14:78044203-78044225 ATAAAATGTCTGCAGAAATACGG - Intergenic
1120047395 14:79823413-79823435 AAAACATCTATGTAGAAATTGGG + Intronic
1120051597 14:79873411-79873433 ATATTTTATCTGGAGAAATGTGG - Intergenic
1120657205 14:87206009-87206031 ATCTCATATCTGGAGCAATATGG - Intergenic
1121502613 14:94450259-94450281 AGATCATATCTGGAGATACTAGG - Intronic
1121950386 14:98166475-98166497 AAAACAAATTTGAAGAAATTGGG - Intergenic
1122063155 14:99150441-99150463 CTGACACATCTGGACAAATTGGG - Intergenic
1123815115 15:23970137-23970159 ATAAGAGCTCTGGAAAAATTAGG - Intergenic
1124069182 15:26375660-26375682 ATCACATAACTTGAGAAAGTAGG - Intergenic
1124924305 15:34056252-34056274 ATTCCATATATGGAGAAACTGGG + Intronic
1126457612 15:48881130-48881152 ATAATATGTATGGATAAATTTGG - Intronic
1126883837 15:53128723-53128745 ATAACATATCTGGAGACAGAGGG - Intergenic
1127293969 15:57593572-57593594 ATAACATTTCTGAAGATTTTGGG + Intronic
1128177647 15:65570313-65570335 ATTACATATGTGGAGAATTCTGG + Intronic
1129128980 15:73473421-73473443 ATTACATGGCTGAAGAAATTGGG + Intronic
1131244223 15:90776007-90776029 TTGACATATCTGGATGAATTGGG + Intronic
1133748316 16:8704349-8704371 ATTAAATATCTGGACACATTGGG + Intronic
1135553817 16:23419001-23419023 AGCAAATATCTGGATAAATTTGG + Intronic
1138258648 16:55595752-55595774 ATATCACATCTTGAGAAACTAGG + Intergenic
1138267477 16:55670160-55670182 AGAACACATCTGCAGAAAGTAGG + Intronic
1138886399 16:61084717-61084739 ATAATATATCTGGAAAAGATTGG + Intergenic
1140278800 16:73535185-73535207 ATTGCATTTCTGGTGAAATTAGG - Intergenic
1148912947 17:50952951-50952973 GGAACATGTCTGGAGAAATTGGG + Intergenic
1149209133 17:54283822-54283844 ATGGCACATTTGGAGAAATTGGG + Intergenic
1151463949 17:74272651-74272673 AACACATATATGGAGAAGTTGGG + Intergenic
1155242720 18:23878954-23878976 AGAAAATATGGGGAGAAATTGGG - Intronic
1155409937 18:25532894-25532916 ATAACAATTCTGGATAAATAAGG - Intergenic
1155804110 18:30144351-30144373 ATAACATATTTCTAGAAACTGGG + Intergenic
1156127775 18:33927914-33927936 ATATAATAGCTGGGGAAATTGGG - Intronic
1156136598 18:34047367-34047389 ATAACATATATTTAGAAACTGGG - Intronic
1156157855 18:34324970-34324992 ATGACATTTCTATAGAAATTGGG - Intergenic
1156716653 18:40020602-40020624 ACAGCATATCTGGATATATTTGG - Intergenic
1156725810 18:40125175-40125197 AAAACACATGTGCAGAAATTTGG + Intergenic
1158756648 18:60332989-60333011 AAAACATATTTGGGGAAATAAGG + Intergenic
1159069129 18:63603596-63603618 ATAACATATGTGCATTAATTAGG - Intronic
1159266465 18:66086990-66087012 GTAACTCATCAGGAGAAATTTGG + Intergenic
1159375932 18:67593108-67593130 AGAACATAGCAGGAGAAAGTGGG - Intergenic
1164153918 19:22577159-22577181 AGAACATGTCTGAAGAAATAGGG + Intergenic
1167909287 19:52689094-52689116 ATAACATATCTTGTGACCTTGGG - Intronic
1168078864 19:53994702-53994724 ATATCACATCTGGAGAAGTGAGG - Intronic
1168368248 19:55808360-55808382 ACAACAGATCTGAAGAAATTAGG + Intronic
925946472 2:8868706-8868728 ATAACATATCTAGGACAATTTGG + Intronic
926607533 2:14912654-14912676 ACAACATACCTAGAGAAACTGGG - Intergenic
927330799 2:21861239-21861261 AGAACTTAATTGGAGAAATTTGG + Intergenic
927997484 2:27496107-27496129 ATCACACAGCTGGACAAATTGGG - Intergenic
928547621 2:32343074-32343096 AAACCGTATCTGGAAAAATTTGG + Intergenic
928796636 2:35030629-35030651 ATAAAATATTTACAGAAATTTGG + Intergenic
929105779 2:38364536-38364558 ATAACAAATATGGAATAATTTGG - Intronic
929378640 2:41322083-41322105 CTGACATAACTGGAGAAATATGG + Intergenic
930080581 2:47444370-47444392 CTAAAATTTCTGGAGAAGTTTGG + Intronic
930917477 2:56711227-56711249 ATAAAATATCTGGAAAATTGCGG + Intergenic
930927681 2:56839197-56839219 ATAACATATCTACAAAATTTGGG + Intergenic
933174717 2:79162316-79162338 ATAACATAGCTACTGAAATTTGG + Intergenic
933395790 2:81729236-81729258 ATAACATATGTAAAGAAAATGGG - Intergenic
934073358 2:88406395-88406417 ATAACGTATTTGTATAAATTAGG + Intergenic
935703252 2:105832481-105832503 ATAACAACTCTGAACAAATTAGG - Intronic
935871777 2:107458558-107458580 ATTTTATATCTGGAGAACTTAGG + Intergenic
941146841 2:161858541-161858563 AAGATATATCTGGAGAATTTTGG - Intronic
941397530 2:164991775-164991797 AGAACTTGTCTGGAGAAGTTTGG + Intergenic
941398524 2:165001810-165001832 ATTACATATCTGAATAAAATAGG - Intergenic
942861666 2:180620843-180620865 ATAAATTCACTGGAGAAATTTGG - Intergenic
943305046 2:186250657-186250679 ATGCCATATTTTGAGAAATTTGG - Intergenic
943538313 2:189180386-189180408 ACAAGAGATGTGGAGAAATTAGG - Intergenic
943821207 2:192324058-192324080 ATAACACATCCAAAGAAATTAGG + Intergenic
944821627 2:203438430-203438452 ATTACATATCTGTAGACAATTGG - Exonic
945341842 2:208665711-208665733 ATTGCATATCTGGTGAGATTTGG + Intronic
945520667 2:210823417-210823439 ATAATATTTCTGGTGAAATAAGG - Intergenic
947088986 2:226489010-226489032 AAAACACATGTTGAGAAATTGGG + Intergenic
948394838 2:237637564-237637586 ATAAAATACCTGGAGAGTTTAGG + Intronic
948714370 2:239850821-239850843 CTCACATATCAGGAGAAATATGG - Intergenic
948821489 2:240551308-240551330 TTAAAAATTCTGGAGAAATTAGG - Intronic
1169428179 20:5512326-5512348 ATATCAATTCTGGAGAAAATCGG - Intergenic
1169819780 20:9697401-9697423 ATAGCATATTTGGAGATATTTGG - Intronic
1170050175 20:12134099-12134121 ATGACATATATGGAGAGATTTGG - Intergenic
1170258383 20:14373252-14373274 ATTATATATCTGGTAAAATTTGG + Intronic
1170451050 20:16484175-16484197 ATAACATTTCTGGAGCAAAAAGG - Intronic
1171362882 20:24602299-24602321 ATAACTTATCTGAAGAAAGGTGG - Intronic
1172745900 20:37208509-37208531 ATAACATATTTAGAAAATTTGGG - Intronic
1173130943 20:40392708-40392730 ATATCATTTCTAGAGAAATGAGG - Intergenic
1177041315 21:16114720-16114742 AAAACATTTTTGTAGAAATTGGG - Intergenic
1177462051 21:21425290-21425312 TTTAGATATTTGGAGAAATTTGG - Intronic
1178177214 21:30116906-30116928 GTAACAGAACTGGAGAAACTAGG + Intergenic
1179207411 21:39294948-39294970 AAAACCTATCTGAAAAAATTTGG - Intronic
1181352254 22:22267442-22267464 CTAACTTGTCTGGAGACATTTGG - Intergenic
1181432540 22:22890967-22890989 ATAACATATTGGGATATATTTGG + Intronic
1181589454 22:23874883-23874905 TTAAAATATCTGTAAAAATTGGG - Intronic
1182673043 22:32013916-32013938 TTAACTTATTTGGAGAATTTGGG + Intergenic
1182750204 22:32635490-32635512 AGAACATATCTGCAAACATTGGG + Intronic
949296328 3:2528338-2528360 ATCTCATATGTGGAGAAATCAGG + Intronic
949748338 3:7322314-7322336 AGAATATATCTGCTGAAATTTGG + Intronic
950897894 3:16469898-16469920 ATAACATATCTGGAGCGGCTGGG - Intronic
950908333 3:16559534-16559556 ATAAAATATCATGACAAATTGGG + Intergenic
951360167 3:21715711-21715733 ATAACATATAGATAGAAATTTGG - Intronic
951841718 3:27041404-27041426 TTAACAAATTTTGAGAAATTAGG + Intergenic
952620430 3:35332797-35332819 ATAAAATATCTCAACAAATTAGG - Intergenic
953213195 3:40894432-40894454 ATAAAATATGTGAAGAAATTGGG - Intergenic
954870480 3:53763872-53763894 ATAACATATCTGCAGCAAGGGGG - Intronic
955298200 3:57753051-57753073 ATGTCATATTTTGAGAAATTGGG - Intergenic
955415868 3:58690329-58690351 TGAACATAACTGCAGAAATTGGG + Intergenic
955776285 3:62437261-62437283 ATGAAATATCTGGCTAAATTAGG + Intronic
955825811 3:62946385-62946407 ATAACATATATGTTCAAATTAGG + Intergenic
956287324 3:67624608-67624630 CTAACATAGATGGAAAAATTTGG - Intronic
956577163 3:70764716-70764738 ATAACTTATCTGTAAAATTTGGG + Intergenic
957501213 3:81058925-81058947 TTAAGATATCAGGAGAAAATAGG - Intergenic
958110012 3:89130474-89130496 TTAACATATTTGGAGAAAAATGG + Intronic
958420410 3:93924062-93924084 TTAACACATGTTGAGAAATTTGG - Intronic
958588676 3:96124628-96124650 ATAAAATCTCTGAAGAAATTAGG + Intergenic
958876918 3:99626947-99626969 ATCTCCTATCTGGAGAAACTAGG - Intergenic
959055734 3:101566176-101566198 ATTAAATATCTGCAGAACTTTGG + Exonic
959540145 3:107526966-107526988 CTTACATGTTTGGAGAAATTAGG + Intronic
959834768 3:110905461-110905483 CTATCATCTCTGGAGAGATTTGG - Intergenic
959989468 3:112615215-112615237 CTCACAAATCTGTAGAAATTCGG + Intronic
961586386 3:127930716-127930738 ATAACACCTCTCTAGAAATTTGG - Intronic
962158870 3:132978087-132978109 ACCTCATATGTGGAGAAATTTGG + Intergenic
962838917 3:139215731-139215753 AGAGCATACCTGGAGAAGTTGGG - Intronic
963732973 3:148990739-148990761 ATAATATAAATGGAGAAAGTAGG - Intergenic
964037433 3:152216917-152216939 ATGAGAAATCTGAAGAAATTAGG - Intergenic
964141753 3:153410318-153410340 ATAAAATATCTGAAGATGTTTGG - Intergenic
964401270 3:156301786-156301808 AAAAAATATCTGGTGAAATTTGG - Intronic
965457091 3:168915363-168915385 ATAACATATATTAACAAATTAGG + Intergenic
965797307 3:172453795-172453817 AAAACATATATAGAGAAATTTGG + Intergenic
971244545 4:24916391-24916413 AAAAAATCTCTGGAGAGATTGGG + Intronic
971730648 4:30375332-30375354 ATATGATTTATGGAGAAATTGGG + Intergenic
972018282 4:34274268-34274290 ATAAAATATCTTGAGAAAGAAGG - Intergenic
973626689 4:52779498-52779520 ATAAGATATTTGGAAAAATATGG + Intergenic
974329249 4:60455151-60455173 AAAATATATCTGTAAAAATTGGG - Intergenic
979162234 4:117477063-117477085 AAAAAATATCTGGAAAAACTGGG - Intergenic
979673258 4:123383624-123383646 ATAAGATATCTTCAGAAATGTGG + Intergenic
980345052 4:131603427-131603449 ATAACATATATGCAAAAATGAGG - Intergenic
980499869 4:133635366-133635388 ATATCCTAACTGGAGGAATTAGG + Intergenic
980848007 4:138347317-138347339 ATAGCATCTCTGGAGAACTAAGG + Intergenic
981189494 4:141844474-141844496 ATAAAATATAAGCAGAAATTTGG - Intergenic
981263354 4:142750260-142750282 GTGATTTATCTGGAGAAATTTGG - Intronic
981418177 4:144518110-144518132 ATAATATATGTGGAAAACTTTGG + Intergenic
982474886 4:155837950-155837972 ATAAGAAATCTGAAGAAATCTGG + Intronic
983294852 4:165853801-165853823 ATTCAATTTCTGGAGAAATTTGG + Intergenic
985805739 5:2041800-2041822 AGAAGATATCTTTAGAAATTTGG - Intergenic
986660640 5:10056988-10057010 AGACCATATCTGGAGTTATTCGG - Intergenic
986907123 5:12508672-12508694 AGAACAAAACTGGAGACATTAGG - Intergenic
986930667 5:12816222-12816244 TTAACACATCTGTAGTAATTGGG + Intergenic
987331040 5:16857945-16857967 ATATCATATCAGAAGTAATTGGG + Intronic
987455091 5:18134433-18134455 ACAACATCACTGGAGAACTTTGG + Intergenic
987581450 5:19798829-19798851 ATAACATATCTTTGGAAATTAGG + Intronic
987689540 5:21249571-21249593 ATAACACATCAGGAGTAATTTGG + Intergenic
988148827 5:27348683-27348705 ATAACCCAGCTGGAGAGATTAGG + Intergenic
988322435 5:29716250-29716272 AAAACATATCTGAAGGATTTGGG - Intergenic
991074883 5:62523992-62524014 ATAACATGTAAGGAGAAATTGGG - Intronic
991074906 5:62524293-62524315 ATAAGATGTAAGGAGAAATTGGG + Intronic
991422858 5:66459061-66459083 ATAAAGTATCTGAAGCAATTGGG + Intergenic
992432430 5:76722340-76722362 AGAACAGACCTGGAGAAATGGGG + Intronic
992864981 5:80949157-80949179 ATAACATATTTGTACAAATATGG + Intergenic
993355826 5:86906056-86906078 ATTTTACATCTGGAGAAATTTGG - Intergenic
994574603 5:101561735-101561757 ATAATATTTTTTGAGAAATTGGG + Intergenic
994696782 5:103081395-103081417 ATAACATCTCTCAACAAATTAGG - Intergenic
994896791 5:105716171-105716193 ATTACATAGCTGTAGTAATTAGG + Intergenic
996512837 5:124336660-124336682 ACAACATGTTTGGAGAGATTTGG - Intergenic
997178590 5:131804421-131804443 ATAACTTATCTGGAAAGTTTGGG + Intergenic
997344255 5:133174906-133174928 ATAACATTTATGGATTAATTTGG + Intergenic
1000941375 5:167365415-167365437 ATAAGATAAGTGCAGAAATTAGG + Intronic
1001689725 5:173624091-173624113 ATAACATATCAGGAGAATTGTGG + Intergenic
1002948412 6:1784582-1784604 AAAACAAATCTGGAGACATCTGG + Intronic
1003573230 6:7269560-7269582 AAGACCTATCTGGAGAGATTTGG + Intronic
1004263701 6:14130760-14130782 ATAAAATGTCTGGCTAAATTGGG + Intronic
1004330907 6:14720162-14720184 AGAACATATCTGTAGCAATGAGG + Intergenic
1004938770 6:20533843-20533865 ATAACATATGTAGAGAAAGCGGG + Intergenic
1005208770 6:23435625-23435647 ATAAAAAATCTGAAGTAATTTGG - Intergenic
1008533626 6:52489036-52489058 ATAACCTTTCAGGAAAAATTTGG - Intronic
1008653511 6:53587634-53587656 ATAAAGTAAATGGAGAAATTGGG - Intronic
1008735584 6:54539738-54539760 AGCACATATTTGGAGTAATTTGG + Intergenic
1009320657 6:62285074-62285096 ATAACATAAATGGAGTAATTCGG + Intronic
1009500070 6:64401610-64401632 ATAAAATATCTGTAGATATATGG - Intronic
1009815486 6:68728230-68728252 ATAACATATTTGGTGATGTTTGG + Intronic
1011891107 6:92160903-92160925 ATACCATATCTGTAGAATATAGG - Intergenic
1012420574 6:99060261-99060283 AAAACTTATCTGCAGAAGTTAGG - Intergenic
1013648177 6:112166232-112166254 ACAACATATCTGGAGAAGATGGG - Intronic
1013868647 6:114728552-114728574 ATAACATTTTTTGAAAAATTAGG + Intergenic
1014269364 6:119319518-119319540 ATAAAATAGCTGAAGAAAATTGG - Intronic
1014379546 6:120723220-120723242 ATAACATTTCTAGAAAAAATAGG - Intergenic
1014420795 6:121243237-121243259 ATAAAAAATATAGAGAAATTTGG + Intronic
1015671262 6:135692752-135692774 ATAGGATAACTAGAGAAATTAGG + Intergenic
1016697164 6:147009466-147009488 TTAAAATATCTTTAGAAATTTGG - Intergenic
1018334104 6:162765686-162765708 AGAACATTTCTGGAGCATTTCGG + Intronic
1020134104 7:5576625-5576647 ATAACATACATTAAGAAATTTGG + Intergenic
1021824537 7:24535739-24535761 AGCAAATATCTGGAAAAATTTGG + Intergenic
1023428155 7:40061412-40061434 TTAAGTTATTTGGAGAAATTTGG + Intronic
1023541078 7:41266466-41266488 ATAAAAAATTTGGAAAAATTAGG + Intergenic
1024287551 7:47772504-47772526 ACACCAAATCTGGAGAAATGAGG - Intronic
1026574191 7:71558259-71558281 ATAAAATATTTGTAGAAATCAGG - Intronic
1026686934 7:72519050-72519072 GCAACAAATCTGGGGAAATTGGG - Intergenic
1027663414 7:81015414-81015436 ACAACACCACTGGAGAAATTTGG + Intergenic
1030911434 7:115255064-115255086 AAAACATGTTTGGAGGAATTTGG + Intergenic
1031030600 7:116730307-116730329 AACACAGATCTGGAGAAGTTGGG + Intronic
1031189128 7:118524159-118524181 ATAATGTAACTGGAGATATTTGG + Intergenic
1032136349 7:129282272-129282294 ATATCAAATTTGGAAAAATTTGG + Intronic
1032185753 7:129724247-129724269 ATATCTTCTCTGGAGAAATTTGG - Intronic
1032965215 7:137088821-137088843 GTAAGATATTTGAAGAAATTTGG - Intergenic
1035490879 7:159277148-159277170 ATAACTTATTTGAAGAAATAAGG - Intergenic
1036548959 8:9800006-9800028 GGAACATATCTAGATAAATTTGG + Intergenic
1037037633 8:14187250-14187272 GTAACATATTTTGAGAAATCTGG - Intronic
1038176706 8:25186704-25186726 ATAACATTTCTGTAGTGATTGGG - Intronic
1038940114 8:32295326-32295348 ATAACACATCTAGAAAATTTGGG + Intronic
1040597061 8:48848694-48848716 ATAACATGTCTGCAAGAATTGGG - Intergenic
1041313728 8:56540870-56540892 ATAACATTTCCGGGGAAAATGGG + Intergenic
1041412854 8:57575597-57575619 ATAACAGAGATGGAGCAATTTGG + Intergenic
1042354516 8:67811749-67811771 ATAACATTTTTGGGGAATTTTGG + Intergenic
1042418222 8:68552118-68552140 ATCACATAGCTAGAGTAATTAGG - Intronic
1042804460 8:72756533-72756555 ATAACATATTTTGGGAAATTGGG + Intronic
1043106419 8:76118025-76118047 CCAACATATCTGTAGAATTTGGG + Intergenic
1043499308 8:80837337-80837359 ATAAAATTTATGGAGAAAATTGG + Intronic
1046378842 8:113425967-113425989 TTCACATATATGGAGAAATCTGG - Intronic
1046755314 8:117967074-117967096 TTAACACATCTTGGGAAATTCGG + Intronic
1047732669 8:127739122-127739144 ATAGCAGATCTGGAGAGATTTGG + Intronic
1048082471 8:131143910-131143932 ATAATATAACTGAATAAATTTGG + Intergenic
1050166795 9:2772980-2773002 CTACCATGTCAGGAGAAATTAGG - Intronic
1050313979 9:4382207-4382229 ATGACACATCTGGAAAAATCAGG + Intergenic
1051070276 9:13157809-13157831 CTAACATATATGGAGATATCTGG - Intronic
1051120126 9:13743742-13743764 ATAACCACTCTGGAGGAATTTGG - Intergenic
1051791302 9:20805728-20805750 AAAACATATCTGTTGAAATGGGG + Intronic
1052129186 9:24820327-24820349 TTAACATATGTGGAGACATTAGG + Intergenic
1052605518 9:30693721-30693743 AAAACATAGCTGCAGAAATTGGG - Intergenic
1052657444 9:31380882-31380904 ATATAATGTCTAGAGAAATTTGG - Intergenic
1053508225 9:38664800-38664822 ATAACAAATCTAAAGAAATGGGG + Intergenic
1055542297 9:77324063-77324085 ATAAAAAATCTGGATAAAATTGG + Intronic
1056472765 9:86921743-86921765 AAAACATTTCAGGATAAATTTGG + Intergenic
1059866127 9:118515710-118515732 ATGACATATCTGGGGAAAAGGGG + Intergenic
1060078997 9:120623902-120623924 ATAACATATTTAGAGGAATGAGG - Intronic
1060570026 9:124630016-124630038 ATAACATGTATGAAAAAATTTGG - Intronic
1062368163 9:136221859-136221881 AAAGCATTTCTGGAGAAACTTGG - Exonic
1191664308 X:63682792-63682814 ATAAAATATCTTCACAAATTAGG + Intronic
1194115969 X:89899276-89899298 CCTAAATATCTGGAGAAATTAGG - Intergenic
1194380855 X:93190378-93190400 ATAACTTTTCTGGATATATTCGG + Intergenic
1194623300 X:96198972-96198994 ATACCCTAGCTGGAGCAATTAGG + Intergenic
1194650946 X:96513401-96513423 ATAAAATATCTAGAAAAATGAGG - Intergenic
1195550297 X:106161774-106161796 AGAGCATTTCTGGAGTAATTGGG - Intergenic
1195622833 X:106974604-106974626 GTAACATATATGAAGTAATTTGG - Intronic
1196117257 X:112011191-112011213 ACTACATATAAGGAGAAATTGGG - Intronic
1196386062 X:115152687-115152709 AAAACATATCTGAAGAAATAAGG + Intronic
1196396658 X:115270624-115270646 ATAACAAATATGGAAAAATATGG + Intergenic
1196539455 X:116888439-116888461 ATAAAATATCTCAAGACATTGGG - Intergenic
1197082386 X:122434989-122435011 AAAACAGATCTGGGAAAATTGGG - Intergenic
1197229495 X:123988591-123988613 ATAAAATATATGAAGTAATTTGG - Intronic
1197576906 X:128225066-128225088 AAATCATATCTGGAGAAATGTGG + Intergenic
1198385908 X:136129229-136129251 ATAACATCTATGGGGAAGTTGGG + Intergenic
1198589513 X:138161534-138161556 ATAACATATCTAGATAAGGTTGG - Intergenic
1199328403 X:146529333-146529355 ATAACCTAATTGGAGAAAATGGG - Intergenic
1200468769 Y:3556401-3556423 CCTAAATATCTGGAGAAATTAGG - Intergenic
1202259348 Y:22953885-22953907 CTAACATATCAGGAGAAGTCAGG - Intergenic
1202412334 Y:24587629-24587651 CTAACATATCAGGAGAAGTCAGG - Intergenic
1202458446 Y:25082441-25082463 CTAACATATCAGGAGAAGTCAGG + Intergenic