ID: 1082187257

View in Genome Browser
Species Human (GRCh38)
Location 11:49198821-49198843
Sequence TCAAGCTGGTCTGCAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82616
Summary {0: 2, 1: 33, 2: 1024, 3: 13732, 4: 67825}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082187255_1082187257 6 Left 1082187255 11:49198792-49198814 CCTTTTAAGGTGGAGTCTTGCTA 0: 1
1: 0
2: 2
3: 29
4: 206
Right 1082187257 11:49198821-49198843 TCAAGCTGGTCTGCAACTCCTGG 0: 2
1: 33
2: 1024
3: 13732
4: 67825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082187257 Original CRISPR TCAAGCTGGTCTGCAACTCC TGG Intronic
Too many off-targets to display for this crispr