ID: 1082187398

View in Genome Browser
Species Human (GRCh38)
Location 11:49200947-49200969
Sequence GATTCATTCTGAACTTGTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082187398 Original CRISPR GATTCATTCTGAACTTGTAT CGG (reversed) Intronic
906781392 1:48575964-48575986 GCTCCATTCTGAACTTTTGTGGG - Intronic
907070431 1:51529794-51529816 GATCCATTCTGAGCTAGTTTTGG - Intergenic
908618425 1:65949046-65949068 GACTCATTCTGAACTTGCTGTGG + Intronic
911762617 1:101633509-101633531 GATTCAGTTTGAACTTGAATGGG + Intergenic
912879635 1:113397377-113397399 GAATAATTTTGAACTTGTTTGGG + Intronic
916829318 1:168474876-168474898 GCTGGATTCTGAACTTGCATGGG + Intergenic
918863351 1:189860987-189861009 GAAATATTCTGAACTTGTTTTGG + Intergenic
919011243 1:191967609-191967631 GATTCTTTCAGAGCTTGTTTAGG - Intergenic
922876721 1:228945517-228945539 CATTGTTTCTGAAGTTGTATTGG - Intergenic
1063747095 10:8896783-8896805 GATTCAGGCAGAACATGTATAGG + Intergenic
1063925913 10:10977184-10977206 GATTCTTCCTGAAATTGTTTTGG + Intergenic
1065429829 10:25642028-25642050 GATTCATGCCGAATTTGTAAAGG - Intergenic
1066434749 10:35387101-35387123 AATCTATTCTGAACTTTTATGGG + Intronic
1068615688 10:59113244-59113266 GACTCATTATCAACTTGTAGAGG - Intergenic
1069020132 10:63477279-63477301 TTTTCATTCTGAAATTGTTTTGG - Intergenic
1069278900 10:66628582-66628604 TATTTATTTTTAACTTGTATTGG + Intronic
1072419492 10:95277804-95277826 GATGCATTATGAACTTGGAGTGG - Intronic
1074806696 10:117060974-117060996 AATTAATGCTGAACTAGTATAGG + Intronic
1076275221 10:129192825-129192847 GATTCTTTCTGAAATTGGAAAGG - Intergenic
1076529057 10:131132531-131132553 GATGAATTTTGAACTTGTGTGGG - Intronic
1077977631 11:7264485-7264507 GATTGATTCTGAAATTTCATTGG + Intronic
1078928431 11:15894741-15894763 TATTCACTCTGGACTTGCATGGG - Intergenic
1080065188 11:28002687-28002709 GCTTCATTTTGGACTTGCATGGG + Intergenic
1082187398 11:49200947-49200969 GATTCATTCTGAACTTGTATCGG - Intronic
1085953367 11:81360028-81360050 GGTTCATTCTCACATTGTATAGG + Intergenic
1086678937 11:89644475-89644497 GATTCATTCTGAACTTGTATCGG + Intergenic
1087876476 11:103364629-103364651 CATGCATTCTGAACTTAAATAGG - Intronic
1091619646 12:2076699-2076721 CATTTATTCTACACTTGTATCGG + Intronic
1092599663 12:10045673-10045695 TCTTCATTCAGAACTTTTATTGG - Intronic
1093371686 12:18374016-18374038 TATTAATTTTGAACTTGAATAGG - Intronic
1098681810 12:73365843-73365865 AATTCACTTTGAACTTGTAAAGG - Intergenic
1099287168 12:80728101-80728123 AATTCATTCTAAATTTGTATGGG - Intergenic
1100800955 12:98229700-98229722 AATTCATTCTGAAGCTTTATTGG + Intergenic
1101052203 12:100874839-100874861 GCTTGGTTTTGAACTTGTATGGG + Intronic
1102638219 12:114343083-114343105 AATTCATTCTGAGCTTAGATGGG + Intergenic
1104021071 12:124992969-124992991 GGTTCATGCTCAACTTGTCTTGG + Intergenic
1105933412 13:25074478-25074500 GATTTATTCTGAAATTGGTTAGG - Intergenic
1107215046 13:37906724-37906746 GATTAATTGTGAACTTGTCTTGG + Intergenic
1107485618 13:40824417-40824439 GACTCATACTGAACTTCTCTGGG + Intergenic
1108625175 13:52221431-52221453 GATTCATATTGAACTTCTCTGGG + Intergenic
1108660879 13:52584986-52585008 GATTCATATTGAACTTCTCTGGG - Intergenic
1115132137 14:30066710-30066732 GATTCATTGTCAATTTTTATGGG + Intronic
1115458319 14:33631106-33631128 GATTCATTTTCAATTTGTATTGG - Intronic
1118495134 14:66301061-66301083 GATTCATTCAGAAGTTGGTTTGG - Intergenic
1120599051 14:86478198-86478220 GATTTAGTCTTAACTTGTTTTGG + Intergenic
1120911949 14:89674890-89674912 AATTAAGTCTGAACTTTTATTGG + Intergenic
1121983976 14:98482136-98482158 AATTCATTCTAAATTTGTTTTGG - Intergenic
1202882698 14_KI270722v1_random:75619-75641 AATCCATTCTAAAATTGTATAGG - Intergenic
1139733650 16:68969021-68969043 GACGCATTCTGAACTTTTTTTGG - Intronic
1146149287 17:30453357-30453379 GCTGGATTCTGAACTTGCATGGG - Intronic
1146194206 17:30797706-30797728 GAATCATTATGAACTTCAATAGG + Intronic
1146812315 17:35913843-35913865 GCTTGATCCTGATCTTGTATTGG + Intergenic
1150664990 17:67125960-67125982 GAATCATTCTTAACTTCTAGAGG - Intronic
1152651586 17:81496541-81496563 GCATCATTATGAACTTGTCTGGG - Intergenic
1153371236 18:4318447-4318469 GATTCAGCCTGCACTTGAATTGG - Intronic
1153690789 18:7591486-7591508 GAATACTTCTGAACTTGTAGTGG - Intronic
1155635518 18:27950337-27950359 GATTCATTCTGAATTTTAAGAGG - Intergenic
1156615769 18:38782921-38782943 GCTCCATTCTGAACTTGAGTGGG - Intergenic
1156700129 18:39815503-39815525 GATTCATTCTCCACTTGCCTGGG + Intergenic
1156842076 18:41620649-41620671 GACTCATTCTGAACATGTAAAGG - Intergenic
1158719219 18:59909027-59909049 GATTCATTCTGGACAAGTGTTGG + Intergenic
1164584980 19:29462744-29462766 CATTCCTTCTGAAATTCTATTGG + Intergenic
1164903883 19:31951118-31951140 GCTTCAGTCTGAAATTTTATAGG - Intergenic
1168670048 19:58234169-58234191 GATAGAATCTAAACTTGTATGGG + Intronic
1202631885 1_KI270706v1_random:7522-7544 AATCCATTCTAAAATTGTATAGG - Intergenic
1202658297 1_KI270708v1_random:44643-44665 AATCCATTCTAAAATTGTATAGG - Intergenic
929263118 2:39888518-39888540 GATTGATTCTTAAATTGGATAGG - Intergenic
929707556 2:44229605-44229627 GATTCATTCTAAACATTTTTTGG + Intronic
938289837 2:130143287-130143309 GATTCATTATGAGCTTGTAACGG + Exonic
938466690 2:131529651-131529673 GATTCATTATGAGCTTGTAATGG - Exonic
940152844 2:150622019-150622041 GATTCATTCTGATCTTATGAAGG + Intergenic
941194370 2:162429750-162429772 TATTCATACTTAACTTGTTTGGG + Intronic
941403765 2:165063408-165063430 GTTTCATCCTGAAATTGTCTGGG - Intergenic
944453791 2:199872789-199872811 TATTCTTTCTAAACTTGTACAGG - Intergenic
945967592 2:216205395-216205417 GACTCTTTATAAACTTGTATGGG - Exonic
946624762 2:221599428-221599450 AAATCATTCTGAACTTGCATAGG + Intergenic
1170403955 20:16016897-16016919 AATTCATCCTGAAATTCTATTGG + Intronic
1170849502 20:19991957-19991979 CATTCATTCTGAAACTGTAAGGG + Intronic
1172735412 20:37123437-37123459 GAATCATTCTGAGCTTTCATTGG - Intronic
1176598196 21:8767000-8767022 AATCCATTCTAAAATTGTATAGG - Intergenic
1180368844 22:11965832-11965854 AATCCATTCTAAAATTGTATAGG + Intergenic
1180377247 22:12105353-12105375 AATCCATTCTAAAATTGTATAGG - Intergenic
1180420259 22:12807907-12807929 AATCCATTCTAAAATTGTATAGG + Intergenic
1181109068 22:20590880-20590902 CATTCATTATGAGCTTGTAATGG + Intergenic
1182826759 22:33272211-33272233 GATTAATTCAAAACCTGTATCGG + Intronic
949270168 3:2206639-2206661 GAGTCAGTCTCAACTTGTATAGG - Intronic
950946413 3:16952958-16952980 AAATCATTCTGTACTTTTATAGG - Intronic
951565278 3:24006776-24006798 GTTTCATTATGAAATTATATTGG + Intergenic
957127463 3:76180145-76180167 GATTAATTCTGAACTTGTTGGGG - Intronic
957653746 3:83042990-83043012 GAGTCATTGTGAACATATATTGG + Intergenic
960129947 3:114045208-114045230 GATTGATTCTGAAATTGGCTTGG - Intronic
961436418 3:126921525-126921547 GATTCATTCAGAATCTGTCTTGG + Intronic
963052716 3:141155848-141155870 TATTAATTCTGACCTTGTTTGGG + Intergenic
964962422 3:162443901-162443923 GATTCATTGTAAATTTTTATGGG + Intergenic
967049269 3:185767314-185767336 GATTTCTTCTGAACTTGTGTTGG - Intronic
967783986 3:193470061-193470083 GATTTGATCTGAACTTGAATGGG + Intronic
970302458 4:14695928-14695950 AATTCATGCTGCACTTTTATTGG + Intergenic
971255880 4:25013050-25013072 CATTCATTCTGAACGTGCAGTGG - Intronic
971799743 4:31272925-31272947 AGTTCATTATGAACTTTTATAGG - Intergenic
972444620 4:39131507-39131529 GTTTCATTCTGAATTTGTGGTGG - Intergenic
973583933 4:52372262-52372284 GATTCACTCTGATCTTGAGTTGG - Intergenic
976982941 4:91254596-91254618 GATTCATTATGGAGTTGGATGGG + Intronic
976991352 4:91370711-91370733 GTTTTATTTTGAATTTGTATGGG + Intronic
977158163 4:93600129-93600151 GATTCATTCTGGAATTTTAATGG - Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978153504 4:105464259-105464281 GCTGGATTCTGGACTTGTATGGG + Intronic
978190168 4:105901847-105901869 AATTCATTCTGAAGCTGTTTTGG + Intronic
979611330 4:122691912-122691934 TATTACTTCAGAACTTGTATAGG + Intergenic
983890610 4:173025784-173025806 AATTCATCCTGAAATTGTAAGGG + Intronic
1202758852 4_GL000008v2_random:90812-90834 AATCCATTCTAAAATTGTATAGG - Intergenic
986406020 5:7425761-7425783 GATTCATGCTGAATAAGTATGGG + Intronic
987727462 5:21720550-21720572 GATTCATTCGTATCTTGAATGGG - Intergenic
990297341 5:54416110-54416132 GATTCACTCTGAACTCACATAGG + Intergenic
993679821 5:90862574-90862596 GATACACTCTGTACTTGTGTGGG + Intronic
995748121 5:115425202-115425224 GAGCCATTCTGTACTTGTTTAGG - Intergenic
995896020 5:117011551-117011573 GACTTATTTTGAACTTGAATGGG - Intergenic
996627987 5:125593171-125593193 GATTCATTGTGGACTTGTGTTGG - Intergenic
998292892 5:140933266-140933288 TATTCATTTGGAACTTGTTTTGG + Intronic
998582707 5:143396565-143396587 CATTCATTCTGTATTTGTACAGG + Intronic
1001460303 5:171906463-171906485 GATTCATTCTGACATCATATAGG - Intronic
1007634527 6:43290595-43290617 GATTTCTTCTGAACTTTTATAGG - Intergenic
1008030924 6:46692985-46693007 CATTCCTTCTGAACTTCTGTCGG + Exonic
1008145587 6:47888032-47888054 GACTCATTCTGTACTGGGATGGG - Intronic
1011582115 6:88880164-88880186 CATTCATTCAGAAATTATATTGG - Intronic
1014843351 6:126245560-126245582 GATTGAATCTGCACTTGCATTGG + Intergenic
1015098219 6:129442716-129442738 GATTGATTCTCAACTGGTAGTGG + Intronic
1015583434 6:134751202-134751224 GATTCATTCTTACATTTTATTGG + Intergenic
1017479257 6:154833258-154833280 GGATCATTCTGTACTGGTATAGG - Exonic
1017484886 6:154893331-154893353 GGTTCATTCAGAACTTTTTTTGG + Intronic
1019778237 7:2925052-2925074 GCTTCATTCTGTTCTTGAATTGG + Intronic
1021251436 7:18331584-18331606 GATACATTTTGAACTTCTTTGGG - Intronic
1021462961 7:20909802-20909824 AATTCGTTCTGACCTTGGATGGG + Intergenic
1021910652 7:25383016-25383038 GACTCAGTCTGAAATTGAATGGG + Intergenic
1024451063 7:49543382-49543404 GGTTCATTCTGCTCTTGAATAGG - Intergenic
1026160511 7:67864447-67864469 AATTCATTGTGAACTGGTGTAGG - Intergenic
1030165516 7:106551076-106551098 GATCCATTCAGAACTTATTTTGG - Intergenic
1030276379 7:107726047-107726069 GATTCATTCTGAATTCCTTTAGG + Intergenic
1032169236 7:129570383-129570405 GATAGATTTTGAAATTGTATGGG + Intergenic
1038654991 8:29442153-29442175 CATTCAGTCTGAAAGTGTATCGG - Intergenic
1038661377 8:29500009-29500031 TATACATTTTGAACTTGTTTGGG + Intergenic
1044243662 8:89916024-89916046 AATTCTTTCTTATCTTGTATTGG - Intronic
1045250140 8:100476035-100476057 GAGTCATTCTTGACTTGTATAGG + Intergenic
1045561492 8:103268222-103268244 GATTGGTTTTGAACTTGAATGGG - Intergenic
1045782653 8:105885954-105885976 GATTCATTCTTAAGGTGTAGTGG - Intergenic
1046208555 8:111038169-111038191 CATTCATTCTGAATCTGTTTGGG - Intergenic
1050005580 9:1126224-1126246 GCCTCATTCTGAACTTTAATAGG - Intergenic
1050600440 9:7245137-7245159 GATTGATTCTGAATGTCTATAGG + Intergenic
1050825721 9:9942833-9942855 CATTCATTTTGAAAATGTATAGG - Intronic
1051756597 9:20407584-20407606 GATTCATACTAAAATTGTAGAGG - Intronic
1051859227 9:21605632-21605654 GATTCATTTTGAACTTATCAAGG + Intergenic
1052987274 9:34496837-34496859 CTTTCATTCTGGACTTGTTTTGG - Intronic
1055147878 9:72958475-72958497 GATGGATTTTGAACTTGTGTAGG - Intronic
1056055521 9:82818862-82818884 TATTCATTTTATACTTGTATGGG + Intergenic
1056232476 9:84560750-84560772 GATTCAGTCTTCACTTGTATTGG + Intergenic
1203690650 Un_GL000214v1:39048-39070 AATCCATTCTAAAATTGTATAGG - Intergenic
1203539640 Un_KI270743v1:75720-75742 AATCCATTCTAAAATTGTATAGG - Intergenic
1203555057 Un_KI270743v1:200111-200133 AATCCATTCTAAAATTGTATAGG + Intergenic
1203645645 Un_KI270751v1:65143-65165 AATCCATTCTAAAATTGTATAGG + Intergenic
1185964275 X:4582540-4582562 GATTCCCTCTGAACTTGTTCTGG - Intergenic
1188404041 X:29784420-29784442 GATGCATTCTGAAATTGCCTTGG + Intronic
1189123470 X:38420602-38420624 GATTCATCCTAAACTTCTCTAGG + Intronic
1192565288 X:72158383-72158405 GCTGGATTTTGAACTTGTATGGG - Intergenic
1192621956 X:72686156-72686178 AATTCTTTCTGAACTGGAATGGG - Intronic
1192695990 X:73416652-73416674 GCTACATTTTGAACTTGCATAGG - Intergenic
1193759107 X:85442823-85442845 GATGAATTTTGAACTTGCATGGG - Intergenic
1196395461 X:115256841-115256863 GATTCCATCTAAAATTGTATTGG + Intergenic
1198367882 X:135960531-135960553 GATTCATTTGGAATTTGTCTAGG - Intergenic
1200945210 Y:8828791-8828813 GATTCAGTCTAGACTTGTAATGG + Intergenic