ID: 1082187398

View in Genome Browser
Species Human (GRCh38)
Location 11:49200947-49200969
Sequence GATTCATTCTGAACTTGTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082187398 Original CRISPR GATTCATTCTGAACTTGTAT CGG (reversed) Intronic