ID: 1082187717

View in Genome Browser
Species Human (GRCh38)
Location 11:49204804-49204826
Sequence CAGGATTCGCTGGTGAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082187717_1082187719 -10 Left 1082187717 11:49204804-49204826 CCTTTATTCACCAGCGAATCCTG 0: 1
1: 1
2: 1
3: 3
4: 84
Right 1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG 0: 1
1: 1
2: 1
3: 2
4: 29
1082187717_1082187720 -9 Left 1082187717 11:49204804-49204826 CCTTTATTCACCAGCGAATCCTG 0: 1
1: 1
2: 1
3: 3
4: 84
Right 1082187720 11:49204818-49204840 CGAATCCTGCAATCATTAGAGGG 0: 1
1: 1
2: 0
3: 4
4: 52
1082187717_1082187722 8 Left 1082187717 11:49204804-49204826 CCTTTATTCACCAGCGAATCCTG 0: 1
1: 1
2: 1
3: 3
4: 84
Right 1082187722 11:49204835-49204857 AGAGGGACTTCAAGTATTTTAGG 0: 2
1: 0
2: 2
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082187717 Original CRISPR CAGGATTCGCTGGTGAATAA AGG (reversed) Intronic
904227358 1:29034036-29034058 CACCATCTGCTGGTGAATAATGG + Intronic
910765378 1:90777042-90777064 CAGGATCTGTTGGAGAATAAAGG + Intergenic
917832001 1:178900823-178900845 TGGGATTCGCTGGTGGTTAAAGG + Intronic
1064445848 10:15392172-15392194 TAGGAGACGCTGGTGAAGAATGG + Intergenic
1067448670 10:46368201-46368223 CAGGTTGGGCTGGTGACTAAGGG + Intergenic
1067588701 10:47492564-47492586 CAGGTTGGGCTGGTGACTAAGGG - Intergenic
1067635829 10:48000655-48000677 CAGGTTGGGCTGGTGACTAAGGG - Intergenic
1070132388 10:73664662-73664684 CAGGTTGGGCTGGTGACTAAGGG - Intergenic
1070577262 10:77688444-77688466 CAAGACTCTCTGGTGAAAAATGG + Intergenic
1071609295 10:87019414-87019436 CAGGTTGGGCTGGTGACTAAGGG + Intergenic
1075601171 10:123770567-123770589 CAGGATTCCCTGATCATTAATGG - Intronic
1076282419 10:129259573-129259595 CACAATTCTCTGGTGAATAACGG - Intergenic
1080106940 11:28520623-28520645 CAGGATTATCTGGTAATTAATGG + Intergenic
1080221803 11:29914548-29914570 CAGGATTCACTCCTGTATAAAGG - Intergenic
1081494859 11:43598251-43598273 CAGGATTCACTTGGGAAGAAGGG - Intronic
1082187717 11:49204804-49204826 CAGGATTCGCTGGTGAATAAAGG - Intronic
1086678595 11:89640593-89640615 CAGGATTCCCTGGTGAATAAAGG + Intergenic
1087398964 11:97640080-97640102 AAGGATTCCCTGTTTAATAAAGG + Intergenic
1089193027 11:116668663-116668685 CAGCATTTGCTGGTCTATAAAGG - Intergenic
1096265167 12:50116975-50116997 CAGGATTCGCTGGTTTAGAGGGG - Intronic
1099981355 12:89607310-89607332 CATAATTCGCTGATGAATGAGGG + Intronic
1100222645 12:92522488-92522510 CAGCATTCACTGTTGAATAAGGG - Intergenic
1103649873 12:122423551-122423573 CAGGATTTTGTGGTGGATAAGGG + Intergenic
1103786355 12:123436176-123436198 CTGGAGGCGCTGGTGAATGAGGG - Exonic
1104685220 12:130780508-130780530 CAGGAGTCGCTGGTGGAGGAGGG - Intergenic
1112692148 13:101908991-101909013 AAGGATTCCCTGTTTAATAAAGG + Intronic
1115607871 14:35023379-35023401 CTGGATTCTCTGGGGAGTAAAGG - Intronic
1117395918 14:55310466-55310488 CAGGATTTACTGATTAATAATGG + Intronic
1117581882 14:57159391-57159413 CAGGATTTGCTGGAGTAGAAAGG + Intergenic
1131349152 15:91681056-91681078 CAGCATTCGTTGGGGGATAAGGG - Intergenic
1134747775 16:16601253-16601275 CAGGATTTGCTCTTGAATGAAGG + Intergenic
1134754700 16:16656541-16656563 GAGGACTGGCTGGAGAATAATGG + Intergenic
1134991360 16:18702501-18702523 GAGGACTGGCTGGAGAATAATGG - Intergenic
1134997693 16:18752410-18752432 CAGGATTTGCTCTTGAATGAAGG - Intergenic
1135301592 16:21333224-21333246 CAGCATTTGCTTGTCAATAAAGG + Intergenic
1138206668 16:55130582-55130604 CAGGGCTCGCTGGTGACAAACGG + Intergenic
1144507805 17:15848178-15848200 CAGGATTCTGTTGTGTATAATGG + Intergenic
1145119513 17:20245113-20245135 CAGGATTCTGTTGTGTATAATGG + Intronic
1145171928 17:20665811-20665833 CAGGATTCTGTTGTGTATAATGG + Intergenic
1145888881 17:28400876-28400898 CAGGATTTACTGGTGAGGAAGGG - Exonic
1148753091 17:49957156-49957178 CAGGATTAGCTGGAGAATAAAGG + Intergenic
1155252815 18:23967950-23967972 CAGGACTCCCTGGTGAAATAAGG - Intergenic
1156070050 18:33196201-33196223 CAGGAGGGGCTGGAGAATAAAGG + Intronic
1165795212 19:38515322-38515344 CAGGCCTCGCTGGGGAAGAAAGG + Intronic
940564718 2:155346750-155346772 AAGGATTCCCTGTTTAATAAAGG - Intergenic
940824690 2:158397557-158397579 CAGCATTTGCTGGTATATAAAGG - Intronic
943473825 2:188329822-188329844 CAGGATTTGCTGATGGATATAGG + Intronic
1170955035 20:20972197-20972219 CAGCACTGGCTGGAGAATAAAGG + Intergenic
1172112109 20:32553110-32553132 CAGGATTTGCTGGTGGAAATGGG - Intronic
1174337760 20:49875456-49875478 CAGGCTGCTCTTGTGAATAAAGG - Intronic
1174902292 20:54512988-54513010 GAGGATCTGCTGGTGTATAAGGG - Intronic
1175627087 20:60498106-60498128 CAGGATTCACTGTTGGAAAATGG + Intergenic
1175799836 20:61795311-61795333 CAGGATACTATGGTGAAGAAAGG - Intronic
1179092143 21:38276300-38276322 TAGGAGTCACTGGGGAATAATGG + Intronic
1179354067 21:40642241-40642263 CAGGCTTCCCTGGTGAAGAGGGG + Intronic
1181081140 22:20416344-20416366 AAGGATTCCCTGTTTAATAATGG - Intergenic
1183994368 22:41621672-41621694 CAGGATTCTATGCTGACTAACGG - Exonic
951805980 3:26643891-26643913 CAGAATTCGCTGGTAAGAAAAGG - Intronic
951870599 3:27357220-27357242 CACCATTCTCTGGTGAATAGTGG - Intronic
958725642 3:97902609-97902631 CAGGATTTGCTGGGGAGTGAGGG - Intronic
967586442 3:191219935-191219957 CAGGATACGTTGGTGATAAAGGG - Intronic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
973592273 4:52454520-52454542 AAGGATTCCCTGTTTAATAATGG - Intergenic
976419805 4:84828188-84828210 CAGGAATAGCTGCTGAAAAATGG + Intronic
977274063 4:94953473-94953495 CAGCATTTGCTTGTGTATAAAGG + Intronic
978418607 4:108505041-108505063 CAGCATTCGCTTGTCCATAAAGG - Intergenic
980519432 4:133911031-133911053 CAGGATTCCCTGTTTAATAATGG + Intergenic
983498403 4:168471238-168471260 AAGGATTGACAGGTGAATAAAGG + Intronic
988355585 5:30169649-30169671 TAAGATTAGTTGGTGAATAAGGG + Intergenic
988685900 5:33525224-33525246 TAGCAATCTCTGGTGAATAATGG - Exonic
996442430 5:123507266-123507288 CAGTACTAGCTGGTGAAGAAAGG + Intergenic
996820632 5:127622868-127622890 CAGGGTTCCCAGGTAAATAAGGG + Intergenic
1000096593 5:157976604-157976626 CAAGATTACCTGGTGAGTAATGG + Intergenic
1010947080 6:81987460-81987482 CAGGATTCAATGATGTATAAGGG + Intergenic
1011398972 6:86938933-86938955 CAGGATGCACTTGTGAATCAGGG + Intronic
1018169982 6:161136957-161136979 GAGGATTCTTTTGTGAATAAGGG + Intronic
1019327947 7:447660-447682 CTGGATTCCGTGGTGAAAAAGGG + Intergenic
1019861829 7:3666098-3666120 CTGGATTAGGAGGTGAATAAAGG - Intronic
1024664700 7:51534966-51534988 CAGCATTTGCTGGTCTATAAAGG + Intergenic
1026637521 7:72097372-72097394 CATCATTCACTGGGGAATAAAGG - Intronic
1038264628 8:26028897-26028919 CAGGACTTGCTGCTGAATCAAGG - Intronic
1045199870 8:99969170-99969192 CAGCATTTGCTTGTGTATAAAGG - Intronic
1048967066 8:139622979-139623001 CAATATTTGCTGGTGAATATGGG - Intronic
1051027007 9:12624974-12624996 CAGCATTCCCTCGTGAATCATGG - Intergenic
1051828105 9:21244083-21244105 CAGGAAACACAGGTGAATAAAGG - Intergenic
1057353820 9:94319700-94319722 CAGGAATCGGGGGTGAATGACGG + Exonic
1057653931 9:96937892-96937914 CAGGAATCGGGGGTGAATGACGG - Exonic
1058132531 9:101269030-101269052 CAAGATAAGATGGTGAATAAAGG - Intronic
1192009449 X:67252126-67252148 CAGCATTTGCTTGTGTATAAAGG - Intergenic
1200915494 Y:8567762-8567784 CATGATTCGCTGAAAAATAAAGG - Intergenic