ID: 1082187719

View in Genome Browser
Species Human (GRCh38)
Location 11:49204817-49204839
Sequence GCGAATCCTGCAATCATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 1, 2: 1, 3: 2, 4: 29}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082187717_1082187719 -10 Left 1082187717 11:49204804-49204826 CCTTTATTCACCAGCGAATCCTG 0: 1
1: 1
2: 1
3: 3
4: 84
Right 1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG 0: 1
1: 1
2: 1
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082187719 Original CRISPR GCGAATCCTGCAATCATTAG AGG Intronic