ID: 1082187719

View in Genome Browser
Species Human (GRCh38)
Location 11:49204817-49204839
Sequence GCGAATCCTGCAATCATTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 1, 2: 1, 3: 2, 4: 29}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082187717_1082187719 -10 Left 1082187717 11:49204804-49204826 CCTTTATTCACCAGCGAATCCTG 0: 1
1: 1
2: 1
3: 3
4: 84
Right 1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG 0: 1
1: 1
2: 1
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082187719 Original CRISPR GCGAATCCTGCAATCATTAG AGG Intronic
920058356 1:203210013-203210035 GCCAAACCTGCAGTCATGAGTGG + Intergenic
921673322 1:217950544-217950566 GTGAAGCCAGCATTCATTAGTGG - Intergenic
1078955933 11:16195064-16195086 GCCAATCCTGCAATACTTGGTGG - Intronic
1081369661 11:42284290-42284312 GCTAATAATGCCATCATTAGGGG + Intergenic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1084720180 11:70900557-70900579 GAGAATCCCGGAATCACTAGGGG - Intronic
1086678593 11:89640580-89640602 GGGAATCCTGCAATCATTAGAGG - Intergenic
1090219989 11:125011691-125011713 CCCAATCCTGCAAATATTAGAGG - Intronic
1097982895 12:65752351-65752373 GTGAATCCTGCAATTATGAGGGG - Intergenic
1103147320 12:118606860-118606882 GGGATTCCTGCAATCATTTCGGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1122020667 14:98835093-98835115 GGCAATCCTGCAATGCTTAGGGG + Intergenic
1127303003 15:57675978-57676000 TCGAATCCTGGAATCTTGAGTGG + Intronic
1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG + Intronic
1128854958 15:71002407-71002429 GTGAATAGTGAAATCATTAGTGG - Intronic
1164481058 19:28611312-28611334 AGGGATCCTGCAATTATTAGAGG + Intergenic
925072855 2:984661-984683 GCACATCCTGCCATCATCAGCGG + Intronic
930527762 2:52551575-52551597 GTGTATTCTGCAACCATTAGAGG - Intergenic
1169928406 20:10806903-10806925 GGAAATTCTGCAATCATTGGAGG + Intergenic
1173874450 20:46361403-46361425 GAGACTCCTGCAGTCATTTGGGG - Intronic
1175856518 20:62123284-62123306 GCGAATCCTGCAAGCCTTTCTGG + Intronic
953225654 3:41017051-41017073 TTGAATGCTGCATTCATTAGAGG - Intergenic
985282383 4:188300261-188300283 GGGAATCCTGCTATCCTTTGTGG - Intergenic
989121395 5:38008049-38008071 GAGACTCCTGAAATGATTAGGGG - Intergenic
996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG + Intergenic
1003626853 6:7748894-7748916 CCTAATCCTGGAATCAGTAGAGG + Intronic
1016049165 6:139512497-139512519 CTGAATCCTGCCATCATTACAGG + Intergenic
1024689243 7:51781196-51781218 TCGTATCCTGCAATGCTTAGTGG - Intergenic
1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG + Intergenic
1035702670 8:1648594-1648616 GCGAATCCTGCATGCAGAAGGGG - Intronic
1045227937 8:100268810-100268832 GCTATTCCTGCAATGATTATTGG - Exonic
1046007054 8:108499830-108499852 CAGAATCCTCCAATCTTTAGTGG - Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1058626603 9:106939852-106939874 GCTGATTCTGCAATCATTTGAGG - Intronic