ID: 1082193367

View in Genome Browser
Species Human (GRCh38)
Location 11:49273473-49273495
Sequence GGTCCCTCCCCCAGCCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193367_1082193376 7 Left 1082193367 11:49273473-49273495 CCCCACTGGCTGGGGGAGGGACC No data
Right 1082193376 11:49273503-49273525 AGGTGATTAGATCATGGGAATGG No data
1082193367_1082193375 2 Left 1082193367 11:49273473-49273495 CCCCACTGGCTGGGGGAGGGACC No data
Right 1082193375 11:49273498-49273520 ATGGGAGGTGATTAGATCATGGG 0: 49
1: 468
2: 3085
3: 6067
4: 10942
1082193367_1082193374 1 Left 1082193367 11:49273473-49273495 CCCCACTGGCTGGGGGAGGGACC No data
Right 1082193374 11:49273497-49273519 CATGGGAGGTGATTAGATCATGG 0: 42
1: 126
2: 611
3: 3695
4: 7260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193367 Original CRISPR GGTCCCTCCCCCAGCCAGTG GGG (reversed) Intergenic
No off target data available for this crispr