ID: 1082193487

View in Genome Browser
Species Human (GRCh38)
Location 11:49274248-49274270
Sequence AGCTGCTTGGAGAAGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082193487_1082193496 13 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193496 11:49274284-49274306 CGGATGTATATGGCGGTCATGGG No data
1082193487_1082193497 14 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193497 11:49274285-49274307 GGATGTATATGGCGGTCATGGGG No data
1082193487_1082193493 6 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193493 11:49274277-49274299 GCCAGCTCGGATGTATATGGCGG No data
1082193487_1082193490 -7 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193490 11:49274264-49274286 AGCAGCTCTCCATGCCAGCTCGG No data
1082193487_1082193498 24 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG No data
1082193487_1082193492 3 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193492 11:49274274-49274296 CATGCCAGCTCGGATGTATATGG No data
1082193487_1082193495 12 Left 1082193487 11:49274248-49274270 CCCTGACACTTCTCCAAGCAGCT No data
Right 1082193495 11:49274283-49274305 TCGGATGTATATGGCGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082193487 Original CRISPR AGCTGCTTGGAGAAGTGTCA GGG (reversed) Intergenic
No off target data available for this crispr